View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8493_low_32 (Length: 241)
Name: NF8493_low_32
Description: NF8493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8493_low_32 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 32184849 - 32185071
Alignment:
| Q |
19 |
ataccatttggaaactcatggcagtattgctgaaaaatagtggttatacccactaactgttacaatattagaaaacaatgcagcaatttatggatgaaac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32184849 |
ataccatttggaaactcatggcagtattgctgaaaaatagtggttatacccactaactgttacaatattagaaaacaatgcagcaatttatggatgaaac |
32184948 |
T |
|
| Q |
119 |
caccaccaagttatattatttagaacacgtaagtagtgcaaactaaagtactatttatatcttatatatttctgaagcagtggtaggacataatcacaat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32184949 |
caccaccaagttatattatttagaacacgtaagtagtgcaaactaaagtactatttatatcttatatatttccgaagcagtggtaggacataatcacaat |
32185048 |
T |
|
| Q |
219 |
tgaatgttttgaatatttctctt |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32185049 |
tgaatgttttgaatatttctctt |
32185071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University