View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8494_low_1 (Length: 296)
Name: NF8494_low_1
Description: NF8494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8494_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 19 - 248
Target Start/End: Complemental strand, 50439131 - 50438902
Alignment:
| Q |
19 |
gcgaagagatagacctgaccttggtaaggttgtactgccagaacttgacagattgagagaacttgctgagcaaaattcaacagatggtagtggcagtagc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50439131 |
gcgaagagatagacctgaccttggtaaggttgtactgccagaacttgacagattgagagaacttgctgagcaaaattcaacagatggtagtggcagtagc |
50439032 |
T |
|
| Q |
119 |
agcagctctataaatatgtcccatgagagacaagtttcactgcttctggtaggtctctacactgtttttccagtatatgataagattttcaataaactct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50439031 |
agcagctctataaatatgtcccatgagagacaagtttcactgcttctggtaggtctctacactgtttttccagtatatgataagattttcaataaactct |
50438932 |
T |
|
| Q |
219 |
taaagcaataggacctaattcatacacatt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
50438931 |
taaagcaataggacctaattcatacacatt |
50438902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 242 - 283
Target Start/End: Original strand, 50437404 - 50437445
Alignment:
| Q |
242 |
acacatttttcgcagattaccataggcccttcaaccgttttc |
283 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
50437404 |
acacatttttcgcagattagcataggcccttcaaccgttttc |
50437445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University