View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8494_low_2 (Length: 291)
Name: NF8494_low_2
Description: NF8494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8494_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 275
Target Start/End: Original strand, 23136855 - 23137135
Alignment:
| Q |
1 |
taacaatattttaattattgcgttctcttgtttgtctggaacagttgaatattttttaaaaggcaaaatatataaataatctc------agaatatatta |
94 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23136855 |
taacaatattttaattattgcgttctcttctttgtctggaacagttgaatattttttaaaaggcaaaatatataaataatctcagtctcagaatatatta |
23136954 |
T |
 |
| Q |
95 |
agttttcaagatacataaagacctcaatacctacaaaaataaataatgcactaaatggaacagttgaattttaagtcagtcttagccgtcgggttgcaat |
194 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23136955 |
agtttgcaagatacataaagacctcaatacctacaaaaataaataatgcactaaatggaacagttgaattttaagtcagtcttagccgtcgggttgcaat |
23137054 |
T |
 |
| Q |
195 |
tgaaatggcctggaggaatgagtcttccaacatatttgatggcataaaaactatggagatgataattttggaaatatatcg |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23137055 |
tgaaatggcctggaggaatgagtcttccaacatatttgatggcataaaaactatggagatgataattttggaaatatatcg |
23137135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University