View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8495_high_2 (Length: 397)
Name: NF8495_high_2
Description: NF8495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8495_high_2 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 352; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 13 - 397
Target Start/End: Original strand, 5435973 - 5436357
Alignment:
| Q |
13 |
ataatactattggactttggtgtcctatcattacctcctccttcaaaattaaccctgtcctcaaggctaccatgaagaccttgatccttcnnnnnnncca |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
5435973 |
ataatactattggactttggtgtcctatcattacctcctccttcaaaattaaccctgtcttcaaggctaccatgaagaccttgatccttcaaaaaaacca |
5436072 |
T |
 |
| Q |
113 |
agttctccacttatgttttctttatttccttctttccttgtgactttaattggctgttgcagtgctttcacgatagctcgttttttctgcctcgtttaat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5436073 |
agttctccacttatgttttctttatttccttctttccttgtgactttaattggctgttgcagtgctttcacgatagctcgttttttccgcctcgtttaat |
5436172 |
T |
 |
| Q |
213 |
tttccaatccttgaggatttgaccttgcagcttcacaacctcacccttccattcaaaacatattgtcctctcatcccagtcaaataccacctaattgcca |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5436173 |
tttccaatccttgaggatttgaccttgcagcttcacaacctcacccttccattcaaaacaaattgtcctctcatcccagtcaaataccacctaattgcca |
5436272 |
T |
 |
| Q |
313 |
agcttttccaaccaagccactcccagaaacatatcaaactctcctaattccaattcatatgcatcaacccctcagcagtgaaatc |
397 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5436273 |
agcttttccaaccaagccactcccagaaacatatcaaactctcctaattccaattcatatgcatcaacccctcagcagtgaaatc |
5436357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University