View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8495_low_16 (Length: 206)
Name: NF8495_low_16
Description: NF8495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8495_low_16 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 3692353 - 3692148
Alignment:
| Q |
1 |
gacaggtttgtgggcttccgaaaaatgggttctttatatgactctaccattgtattttggcggtggattgactgcatggttcgtgcacatatggaaggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3692353 |
gacaggtttgtgggcttccgaaaaatgggttctttatatgactctaccattgtattttggcggtggattgactgcatggttcgtgcacatatggaaggat |
3692254 |
T |
|
| Q |
101 |
tctcgccggaaaagctcacgtccattccatctttcacgccacaggtttaggtttcctcgtggacatccttatccacttccttcgctctgggaagacttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3692253 |
tctcgccggaaaagctcacgtccattccatctttcacgccacaggtttaggtttcctcgtggacatccttatccacttccttcgctctgggaagacttca |
3692154 |
T |
|
| Q |
201 |
aatctt |
206 |
Q |
| |
|
|||||| |
|
|
| T |
3692153 |
aatctt |
3692148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University