View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8495_low_5 (Length: 340)
Name: NF8495_low_5
Description: NF8495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8495_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 18 - 323
Target Start/End: Original strand, 5436334 - 5436639
Alignment:
| Q |
18 |
catcaacccctcagcagtgaaatcctctaactgaacctctagattagtatgcttagcccacattgatattttctgaccatcacccaacctcactctcctg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5436334 |
catcaacccctcagcagtgaaatcctctaactgtacctctagattagtatgcttagcccacattgatattttctgaccatcacccaacctcactctcctg |
5436433 |
T |
|
| Q |
118 |
gcttagtatggaccgacccttacacccaacatcgctgacacttgaggcaaaatcgaagttgtggtttgtaccaaagtcgacctaaatcacaattcgtact |
217 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| ||||||||||| ||||| |
|
|
| T |
5436434 |
gcttagtatgacccgacccttacacccaacatcgctgacacttgaggcaaaatcgaagttgtggtttgcaccaatgtcgaccaaaatcacaattggtact |
5436533 |
T |
|
| Q |
218 |
cccttcaaacaccccactagttgtagtgttgcaggtttgacgaccttgagtttgttgacctccgtcatttcacacagccccattgagttatagacaagta |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5436534 |
cccttcaaacaccccactagttgtagtgttgcaggtttgacaaccttgagtttgttgacctccgtcatttcacacagccccattgagttatagacaagta |
5436633 |
T |
|
| Q |
318 |
tgtctt |
323 |
Q |
| |
|
|||||| |
|
|
| T |
5436634 |
tgtctt |
5436639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University