View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8495_low_8 (Length: 261)
Name: NF8495_low_8
Description: NF8495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8495_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 22 - 242
Target Start/End: Complemental strand, 28249623 - 28249403
Alignment:
| Q |
22 |
agaatgggttgtagtctaatgggtgaaatctgtacagagatatttttatttttcaaaatggatggatgttggcatgtggtatgcacaagtgggtaaaatg |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28249623 |
agaatgggttgtagtctaatgggtgaaatctgtacagagatgtttttatttttcaaaatggatggatattggcatgtggtatgcacaagtgggtaaaatg |
28249524 |
T |
 |
| Q |
122 |
attttgttttattctttgttgtgaacaaaatgaaagttggttttcttccatttggttggcaagtggcgagtgaagtttggttcgtctttaaccatgcaca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28249523 |
attttgttttattctttgttgtgaacaaaatgaaagttggttttcttccatttggttggcaagtggcgagtgaagtttggttcgtctttaaccatgcaca |
28249424 |
T |
 |
| Q |
222 |
aacaatttattgggtgataga |
242 |
Q |
| |
|
||||||||||||| ||||||| |
|
|
| T |
28249423 |
aacaatttattggatgataga |
28249403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University