View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8495_low_9 (Length: 259)
Name: NF8495_low_9
Description: NF8495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8495_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 18 - 161
Target Start/End: Original strand, 3915777 - 3915919
Alignment:
| Q |
18 |
gaattttcttttccctttttaatttacttggtttgaaataaaatgtaggagacttgaaaacaatgacttaactggggacgtgacgtcgcttgtaaactgt |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| ||| |
|
|
| T |
3915777 |
gaattttcttttcccttttta-tttacttggtttgaaataaaatgtaggagacttgaaaacaatgacttaactggggacgtgacatcacttgtaaattgt |
3915875 |
T |
|
| Q |
118 |
cgtagtctctctctgctgtgagtttagccttttttggaacaaat |
161 |
Q |
| |
|
| |||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
3915876 |
cttagtctctctctgctgtgagtttagcatttttttgaacaaat |
3915919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 96; Significance: 4e-47; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 55 - 150
Target Start/End: Complemental strand, 34959488 - 34959393
Alignment:
| Q |
55 |
ataaaatgtaggagacttgaaaacaatgacttaactggggacgtgacgtcgcttgtaaactgtcgtagtctctctctgctgtgagtttagcctttt |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34959488 |
ataaaatgtaggagacttgaaaacaatgacttaactggggacgtgacgtcgcttgtaaactgtcgtagtctctctctgctgtgagtttagcctttt |
34959393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University