View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8496_high_14 (Length: 310)
Name: NF8496_high_14
Description: NF8496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8496_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 19 - 301
Target Start/End: Original strand, 35164972 - 35165254
Alignment:
| Q |
19 |
aagtgtaattgtggtccaagcactagtcgaggttatgaatcactccctgatgccggtattagtgggacaagaggactctattctagtagggtaggttatg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35164972 |
aagtgtaattgtggtccaagcactagtcgaggttatgaatcacgccctgatgccggtattagtgggacaagaggactctattctagtagggtaggttatg |
35165071 |
T |
 |
| Q |
119 |
ggggcagtattcattatcattgcagtagaaattgcatgcaggtttaaccattttctttagaaacaagtcacttattgcatatctgttttaatcgattgtt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35165072 |
ggggcagtattcattatcattgcagtagaaattgcatgcaggtttaaccattttctttagaaacaagtcacttattgcatatctgttttaatcgattgtt |
35165171 |
T |
 |
| Q |
219 |
tagagaactgaagataaaacttcattaatctagagccttcttaataacatctagagcatcccatcagtcatttcaagaattat |
301 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35165172 |
tagagaaccgaagataaaacttcattaatctagagctttcttaataacatctagagcatcccatcagtcatttcaagaattat |
35165254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 29 - 127
Target Start/End: Original strand, 37292022 - 37292120
Alignment:
| Q |
29 |
gtggtccaagcactagtcgaggttatgaatcactccctgatgccggtattagtgggacaagaggactctattctagtagggtaggttatgggggcagta |
127 |
Q |
| |
|
|||||||| ||||| || ||||||||||||| ||||| | | ||| || |||||||| |||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
37292022 |
gtggtccaggcactggtggaggttatgaatctggccctggtactggttttggtgggacaggaggaccctattctagtaggggaggttatgggggcagta |
37292120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 195 - 269
Target Start/End: Original strand, 37292256 - 37292330
Alignment:
| Q |
195 |
gcatatctgttttaatcgattgtttagagaactgaagataaaacttcattaatctagagccttcttaataacatc |
269 |
Q |
| |
|
|||| |||||||||||| |||| ||||| ||| ||||||| |||||||| |||||||||| |||| || |||||| |
|
|
| T |
37292256 |
gcatgtctgttttaatcaattgcttagacaaccgaagatagaacttcatcaatctagagctttctgaacaacatc |
37292330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 141 - 192
Target Start/End: Original strand, 37292165 - 37292216
Alignment:
| Q |
141 |
cagtagaaattgcatgcaggtttaaccattttctttagaaacaagtcactta |
192 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||| ||||| |||||| |
|
|
| T |
37292165 |
cagtagaaattgcatgcaggtttaagcattttctctagttacaaggcactta |
37292216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 245 - 289
Target Start/End: Original strand, 37292331 - 37292375
Alignment:
| Q |
245 |
aatctagagccttcttaataacatctagagcatcccatcagtcat |
289 |
Q |
| |
|
|||||||||| |||| || |||||||||||| ||||||||||||| |
|
|
| T |
37292331 |
aatctagagctttctgaacaacatctagagcttcccatcagtcat |
37292375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University