View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8496_low_26 (Length: 286)
Name: NF8496_low_26
Description: NF8496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8496_low_26 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 17 - 286
Target Start/End: Complemental strand, 42726661 - 42726392
Alignment:
| Q |
17 |
acattatatcagtaacagtgaacaataattgaatttggcaaaaaccaacgtcaccagactcaccaccattcgttattattgtactgatttatcatcatat |
116 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42726661 |
acattatatcagtaacattgaacaataattgaatttggcaaaaaccaacgtcaccagactcaccaccattcgttattattgtactgatttatcatcatat |
42726562 |
T |
 |
| Q |
117 |
tatgacaacacgcgtttgtgctatatgataatgataatggaagagggtctaaatgtaacatatgccacaagaacatttgattaaaccaaaccccttccag |
216 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42726561 |
tatgacaacacgcgttagtgctatatgataatgataatggaagagggtctaaatgcaacatatgccacaagaacatttgattaaaccaaaccccttccag |
42726462 |
T |
 |
| Q |
217 |
ctatgttttgtcatattcgtaaatttgtatctgccacatataatatctgactaccatgctctcctgtgac |
286 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42726461 |
ctatgttttgtcatattcataaatttgtatctgccacatataatatctgactaccatgctctcctgtgac |
42726392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University