View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8496_low_27 (Length: 276)
Name: NF8496_low_27
Description: NF8496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8496_low_27 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 87; Significance: 9e-42; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 42 - 191
Target Start/End: Complemental strand, 20683413 - 20683269
Alignment:
| Q |
42 |
ttgatttatctgaggtttcattaaccaaagtaagcaagttgnnnnnnnnnnnnnnnnntacatacattgcagatgaaacaatggtcaagatgattgtaga |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20683413 |
ttgatttatctgaggtttcattaaccaaagtaagcaagttgaaaaaaaaaaaaa-----acatacattgcagatgaaacaatggtcaagatgattgtaga |
20683319 |
T |
|
| Q |
142 |
cattattgttggaaacttcctcttgtttgaatgatttccaagacatggac |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
20683318 |
cattattgttggaaacttcctcttgtttgaatgatttcgaagacatggac |
20683269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 194 - 258
Target Start/End: Complemental strand, 20682894 - 20682827
Alignment:
| Q |
194 |
tattaggttcaatatttatctcttatctacctgctacta---cagctacttcctgcaaagcctgagga |
258 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
20682894 |
tattaggttcaatatgtatctcttatctacctgctactactgcagctacttcctgcaaagcctgagga |
20682827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 188
Target Start/End: Original strand, 20682341 - 20682425
Alignment:
| Q |
104 |
tacattgcagatgaaacaatggtcaagatgattgtagacattattgttggaaacttcctcttgtttgaatgatttccaagacatg |
188 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||| | ||||||| ||||||||||||||||| || |||||| ||||||| |
|
|
| T |
20682341 |
tacattgcagatgaatcgatggtcaagatgattgtagataatattgttcgaaacttcctcttgtttaaaagatttcggagacatg |
20682425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 101 - 191
Target Start/End: Complemental strand, 20681833 - 20681746
Alignment:
| Q |
101 |
acatacattgcagatgaaacaatggtcaagatgattgtagacattattgttggaaacttcctcttgtttgaatgatttccaagacatggac |
191 |
Q |
| |
|
||||||| ||| || ||||| ||| ||||||||||||||||||||||| || ||| ||||||||||||| |||||| |||||||||| |
|
|
| T |
20681833 |
acatacaatgctgacgaaacgatgaccaagatgattgtagacattattgatgaaaa---cctcttgtttgaaagatttcagagacatggac |
20681746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University