View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8496_low_29 (Length: 268)
Name: NF8496_low_29
Description: NF8496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8496_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 19 - 264
Target Start/End: Complemental strand, 3522971 - 3522730
Alignment:
| Q |
19 |
gttcaaaatactcttctttcnnnnnnntcttggacgaggaaatcttcaaggtagtccatatataattccaaaggaaacaaaagttcaggcccgaatggtt |
118 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3522971 |
gttcaaaatactcttctttcaaaaaaatcttggaggaggaaatcatcaaggtagtccata----attccaaaggaaacaaaagttcaggcccgaatggtt |
3522876 |
T |
|
| Q |
119 |
tcaactgtgaattttttaagcctcttttgaggtctcctcaaggtggaaagtgttggtaatgttcgaccaattcaatcaaaatgaatgtcttccaaactat |
218 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
3522875 |
tcaactgtgaattttttaagccttttttgaggtctcctcaaggtggaaagtgttggtaatgttggatcaattcaatcaaaatgaatgtcttccaaactat |
3522776 |
T |
|
| Q |
219 |
ttttccttctannnnnnncctctcattccaaaggtctctgcttctc |
264 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
3522775 |
ttttccttctatttttttactctcattccaaaggtccttgcttctc |
3522730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University