View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8496_low_32 (Length: 250)
Name: NF8496_low_32
Description: NF8496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8496_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 39692617 - 39692397
Alignment:
| Q |
1 |
tcatatggtaaaataggacatttggtacgctggaatacaagtttgaacatacaaattatccgggttttgtgt----aagtttcgcggttatactctttaa |
96 |
Q |
| |
|
|||||||| ||||| ||||||||| |||||||||| ||||||||||||||||||||| |||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
39692617 |
tcatatgggaaaatcggacatttgctacgctggaacacaagtttgaacatacaaattctccgttttttgtgtgtgcaagtttcgctgttatactctttaa |
39692518 |
T |
|
| Q |
97 |
aacaaaaaagaaagtgaatttttcgagatgatgaaattaattagaattataaattttgatatgtttgaaannnnnnnatttgaattgattctaacaaaat |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||| |
|
|
| T |
39692517 |
aacaaaaaagaaagtgaatttttcgagatgatgaaattaattagaattataaattttgatatgtttgaaaaaattttacttgaattgattataacaaaat |
39692418 |
T |
|
| Q |
197 |
caaaatttagagcttttattt |
217 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
39692417 |
caaaatttagagctttaattt |
39692397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University