View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8496_low_35 (Length: 241)
Name: NF8496_low_35
Description: NF8496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8496_low_35 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 7383944 - 7383721
Alignment:
| Q |
1 |
ttatagtaagaaatcatttgagggaaattatggtagttgtaagattttagttaaaacaacactaaaagtttacctattttgtgtcctgataaattaataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7383944 |
ttatagtaagaaatcatttgagggaaattatggtagttgtaagattttagttaaaacaacactaaaagtttacctattttgtgtcctgataaattaataa |
7383845 |
T |
 |
| Q |
101 |
tttcttgaatgcgatattaacatttttgactcatttaactacattgttttgacaacaaaaaactggtagagatgttttcattgctgcaaacacaacgaaa |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7383844 |
tttcttgaatgtgatattaacatttttgactcatttaactacattgttttgacaacaaaaaactggtagagatgttttcattgctgcaaacacaacgaaa |
7383745 |
T |
 |
| Q |
201 |
atatatgttaattttgctaattat |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
7383744 |
atatatgttaattttgctaattat |
7383721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University