View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8496_low_39 (Length: 227)
Name: NF8496_low_39
Description: NF8496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8496_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 18 - 212
Target Start/End: Complemental strand, 27737510 - 27737308
Alignment:
| Q |
18 |
aattcaacttgttattacctctctatcctgcagtcaaattctattttccca----------gtttaattttgtggataagtgtttcgtatggtatagcat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27737510 |
aattcaacttgttattacctctctatcctgcagtcaaattctattttcccatattttcccagtttaattttgtggataagtgtttcgtatggtatagcat |
27737411 |
T |
 |
| Q |
108 |
tgctcaatatggtccaccttgaagacctttnnnnnnnnnnntatatgatccagcttgaagagattatccaaatgttaatataaatttactttcctttctt |
207 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27737410 |
tgctcaatatggtccacctttaagaccttt--caaaaaaaatatatgatccagcttgaagatattatccaaatgttaatataaatttactttcctttctt |
27737313 |
T |
 |
| Q |
208 |
tttct |
212 |
Q |
| |
|
||||| |
|
|
| T |
27737312 |
tttct |
27737308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University