View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8497_high_5 (Length: 230)
Name: NF8497_high_5
Description: NF8497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8497_high_5 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 89 - 230
Target Start/End: Complemental strand, 8091906 - 8091767
Alignment:
| Q |
89 |
ttattgtttagagattgaggttttaataaatttgtgcttggatttaggactttctgtttttcttttgcccttatataataatagatttgaatttcattac |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
8091906 |
ttattgtttagagattgaggttttaataaatttgtgcttggatttaggactttctctttttcttttgcccttatat---aatagatttgaattccattac |
8091810 |
T |
|
| Q |
189 |
taagggaaacaatatctg-atatatagtacgtctttatagttt |
230 |
Q |
| |
|
|||||||||||||||||| |||||| |||||| | |||||||| |
|
|
| T |
8091809 |
taagggaaacaatatctgcatatatggtacgtttatatagttt |
8091767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 8091972 - 8091928
Alignment:
| Q |
1 |
ttgagtgttctaccatacaaaacaatgtggattagcttctatgtt |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8091972 |
ttgagtgttctaccatacaaaacaatgtggattagcttctgtgtt |
8091928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University