View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8497_low_11 (Length: 241)
Name: NF8497_low_11
Description: NF8497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8497_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 117 - 224
Target Start/End: Complemental strand, 19251584 - 19251477
Alignment:
| Q |
117 |
ggacaagttgatacagttagatatcatattcatattgatttgaaaggtatatatatcgttattgaaatgtgcctaatttaatttcattccaacaaatagg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
19251584 |
ggacaagttgatacagttagatatcatattcatattgatttgaaaggtatatctattgttattgaaatgtacctaatttaatttcattccaacaagtagg |
19251485 |
T |
 |
| Q |
217 |
atgcttgt |
224 |
Q |
| |
|
|||||||| |
|
|
| T |
19251484 |
atgcttgt |
19251477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University