View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8497_low_9 (Length: 255)
Name: NF8497_low_9
Description: NF8497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8497_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 149 - 235
Target Start/End: Original strand, 28524778 - 28524864
Alignment:
| Q |
149 |
ataaaaatgtagataaattattgcataaactttccaatttcattttcattatgcctttttatttctcgatgcaaaacttagataccc |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28524778 |
ataaaaatgtagataaattattgcataaactttccaatttcattttcattatgcctttttatttctcgatgcaaaacttagataccc |
28524864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University