View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8498_high_19 (Length: 244)
Name: NF8498_high_19
Description: NF8498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8498_high_19 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 244
Target Start/End: Complemental strand, 37924703 - 37924478
Alignment:
| Q |
19 |
atgaattgggacataaacaaagataaagtcttcaatttcactatcattataaagtattaacacaaacatggacattgacactaacacatgtcgaacccat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37924703 |
atgaattgggacataaacaaagataaagtcttcaatttcactatcattatagagtattaacgcaaacacggacattgacactaacacatgtcgaacccat |
37924604 |
T |
 |
| Q |
119 |
aacacgacttcaatatgaagtgttgcaacatagtaaattagacaatttgggatgttaattaggaaataaacaaagatcaagtcttcaatttcccccattt |
218 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37924603 |
aacacgacttcaatataaagtgttgcaacatagtaaattagacaatttgggatgttaattaggaaataaacaaagatcaagtcttcaatttcccccattt |
37924504 |
T |
 |
| Q |
219 |
taaacccttcaatttcacttgtcatt |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
37924503 |
taaacccttcaatttcacttgtcatt |
37924478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University