View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8498_low_24 (Length: 244)

Name: NF8498_low_24
Description: NF8498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8498_low_24
NF8498_low_24
[»] chr5 (1 HSPs)
chr5 (19-244)||(37924478-37924703)


Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 244
Target Start/End: Complemental strand, 37924703 - 37924478
Alignment:
19 atgaattgggacataaacaaagataaagtcttcaatttcactatcattataaagtattaacacaaacatggacattgacactaacacatgtcgaacccat 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |||||||||||||||||||||||||||||||    
37924703 atgaattgggacataaacaaagataaagtcttcaatttcactatcattatagagtattaacgcaaacacggacattgacactaacacatgtcgaacccat 37924604  T
119 aacacgacttcaatatgaagtgttgcaacatagtaaattagacaatttgggatgttaattaggaaataaacaaagatcaagtcttcaatttcccccattt 218  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37924603 aacacgacttcaatataaagtgttgcaacatagtaaattagacaatttgggatgttaattaggaaataaacaaagatcaagtcttcaatttcccccattt 37924504  T
219 taaacccttcaatttcacttgtcatt 244  Q
    ||||||||||||||||||||||||||    
37924503 taaacccttcaatttcacttgtcatt 37924478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University