View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8498_low_25 (Length: 238)
Name: NF8498_low_25
Description: NF8498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8498_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 18731909 - 18732128
Alignment:
| Q |
1 |
aaacaaaacacataatttgagacaaatggagtaaaatatatgatttattaaatcaatttattaataatgtgttttatattagtctaaagttattaatcat |
100 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18731909 |
aaacaaaacacataatttgagacagatagagtaaaatatatgatttattaaatcaatttattaatcatgtgttttatattagtctaaagttattaatcat |
18732008 |
T |
 |
| Q |
101 |
gtgttttctactactctaaatttaaattgaggtctttagaaatcaatttagggtcaaactacattgtctctatttatacacnnnnnnngaaattgaaata |
200 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18732009 |
gtgttttctacta---taaatttaaagtgaggtctttagaaatcaatttaggttcaaactacattgtctctatttatacacaaaaaaagaaattgaaatc |
18732105 |
T |
 |
| Q |
201 |
taattctgagtataatttcttta |
223 |
Q |
| |
|
|||| | |||||||||||||||| |
|
|
| T |
18732106 |
taataccgagtataatttcttta |
18732128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University