View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8499_high_20 (Length: 249)
Name: NF8499_high_20
Description: NF8499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8499_high_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 50373286 - 50373046
Alignment:
| Q |
1 |
aaactatctattaggcgctagttagcaagcacacatagtattaggttggattgaagtgtttagcttccactaactttctaaaatgtatagatgaccgtaa |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50373286 |
aaactatctattaggcgctagttggcaagcacacatagtattaggttggattgaagtgtttagcttccactaactttctaaaatgtatagatgaccgtaa |
50373187 |
T |
|
| Q |
101 |
aaagtagaattagtgtgcagttaagctgttttctctcatcattctgcaaattggattgtggctctcatcattctcacgtttactttgtttctttggaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
50373186 |
aaagtagaattagtgtgcagttaagctgttttctctcatcattctgcaaattggattgtggctctcatcattctaacgtttactttgtttctttggaaca |
50373087 |
T |
|
| Q |
201 |
agaggtttagctttgaaaatcaccaccccacaggttctgct |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
50373086 |
agaggtttagctttgaaaatcaccaccccaggggttctgct |
50373046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 57 - 95
Target Start/End: Original strand, 48272529 - 48272567
Alignment:
| Q |
57 |
tgtttagcttccactaactttctaaaatgtatagatgac |
95 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
48272529 |
tgtttagcttgcactaactttctaaaatgtatagatgac |
48272567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University