View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8499_high_25 (Length: 214)
Name: NF8499_high_25
Description: NF8499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8499_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 47 - 197
Target Start/End: Original strand, 32946113 - 32946267
Alignment:
| Q |
47 |
ctttgtgtcggcacaagcccacacaatcttcaaaatacatccgtccctgattgagtttggatcaaat----gatgtgagagactcacacttgagggagag |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32946113 |
ctttgtgtcggcacaagcccacacaatcttcaaaatacatccgtccctgattgagtttggatcaaatatatgatgtgagagactcacacttgagggagag |
32946212 |
T |
 |
| Q |
143 |
attgctggattagtgtgattgtttataccaaaattgacatgtaaatgagaaaaat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32946213 |
attgctggattagtgtgattgtttataccaaaattgacatgtaaatgagaaaaat |
32946267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University