View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8499_low_22 (Length: 266)
Name: NF8499_low_22
Description: NF8499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8499_low_22 |
 |  |
|
| [»] scaffold0170 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0170 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: scaffold0170
Description:
Target: scaffold0170; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 15 - 193
Target Start/End: Original strand, 7542 - 7720
Alignment:
| Q |
15 |
gaacattcattagaagaccctttttaaaactctattgatctaatcatttctcaaccgtggcaagtatgacaagagcaatgttattgagccacatcatctt |
114 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7542 |
gaacactcattagaagaccctttttaaaactctatcgatctaatcatttctcaaccgtggcaagtatgacaagagcaatgttattgagccacatcatctt |
7641 |
T |
 |
| Q |
115 |
atgattatccacgttcgatgaggataataaaatatgtagctgcacatattctataacagatttatttgtcatcatgata |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7642 |
atgattatccacgttcgatgaggataataaaatatgtagctgcacatattctataatagatttatttgtcatcatgata |
7720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University