View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8499_low_22 (Length: 266)

Name: NF8499_low_22
Description: NF8499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8499_low_22
NF8499_low_22
[»] scaffold0170 (1 HSPs)
scaffold0170 (15-193)||(7542-7720)


Alignment Details
Target: scaffold0170 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: scaffold0170
Description:

Target: scaffold0170; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 15 - 193
Target Start/End: Original strand, 7542 - 7720
Alignment:
15 gaacattcattagaagaccctttttaaaactctattgatctaatcatttctcaaccgtggcaagtatgacaagagcaatgttattgagccacatcatctt 114  Q
    ||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7542 gaacactcattagaagaccctttttaaaactctatcgatctaatcatttctcaaccgtggcaagtatgacaagagcaatgttattgagccacatcatctt 7641  T
115 atgattatccacgttcgatgaggataataaaatatgtagctgcacatattctataacagatttatttgtcatcatgata 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
7642 atgattatccacgttcgatgaggataataaaatatgtagctgcacatattctataatagatttatttgtcatcatgata 7720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University