View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8499_low_29 (Length: 253)

Name: NF8499_low_29
Description: NF8499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8499_low_29
NF8499_low_29
[»] chr3 (1 HSPs)
chr3 (95-251)||(2911753-2911904)


Alignment Details
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 95 - 251
Target Start/End: Complemental strand, 2911904 - 2911753
Alignment:
95 ttttggtacctatgggatgctaccacctatcattctcttctctctattttctttcttaatctcaactttatagtactatactacatatcatatttatgga 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||     ||||||||||||    
2911904 ttttggtacctatgggatgctaccacctatcattctcttctctctattttctttcttaatctcaactttatagtactatgcta-----catatttatgga 2911810  T
195 tggattttggagtatatagtatacaataatgtaagaattaaataataaagtcttcat 251  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2911809 tggattttggagtatatagtatacaataatgtaagaattaaataataaagtcttcat 2911753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University