View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8499_low_34 (Length: 226)
Name: NF8499_low_34
Description: NF8499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8499_low_34 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 14 - 210
Target Start/End: Original strand, 41927962 - 41928158
Alignment:
| Q |
14 |
attatactatctttttagcaagatgaaattgtacctttcttgttatcatgcaatataatacactcatgatgcataataatgttttagttttgatatttat |
113 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41927962 |
attatactatctttttagcaagatgagattgtacctttcttgttatcatgcaatataatacactcatgatgcataataatgttttagttttgatatttat |
41928061 |
T |
|
| Q |
114 |
tttcttgcaagtgatttctcctttctaatgtaaaccattatacaataatataaatgtgttgcaccgaccacgattcaatttcaatgagttttcttag |
210 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41928062 |
tttctggcaagtcatttctcctttctaatgtaaaccattatacaataatataaatgtgttgcaccgaccacgattcaatttcaatgagttttcttag |
41928158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University