View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8499_low_8 (Length: 395)
Name: NF8499_low_8
Description: NF8499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8499_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 81; Significance: 5e-38; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 96 - 180
Target Start/End: Original strand, 9833415 - 9833499
Alignment:
| Q |
96 |
ttaattcacctgttgaacgagactacgaatttcttgaggagtcataagatgagagaattcaacatcaacaataacattctgccct |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9833415 |
ttaattcacctgttgaacgagactacgaatttcttgaggagtcataagatgagagaattcaacatcaacaacaacattctgccct |
9833499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 312
Target Start/End: Original strand, 9833587 - 9833631
Alignment:
| Q |
268 |
gcttcaatcaccttcactctctcttcctctgttatccccgctata |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9833587 |
gcttcaatcaccttcactctctcttcctctgttatccccgctata |
9833631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 20 - 58
Target Start/End: Original strand, 9833363 - 9833401
Alignment:
| Q |
20 |
taatctacatttcaaatcaaaataatttaccataaacaa |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9833363 |
taatctacatttcaaatcaaaataatttaccataaacaa |
9833401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 268 - 309
Target Start/End: Complemental strand, 51681989 - 51681948
Alignment:
| Q |
268 |
gcttcaatcaccttcactctctcttcctctgttatccccgct |
309 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
51681989 |
gcttcaatcaccttcactctctcttcctccgttatccccgct |
51681948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 271 - 307
Target Start/End: Original strand, 47728470 - 47728506
Alignment:
| Q |
271 |
tcaatcaccttcactctctcttcctctgttatccccg |
307 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
47728470 |
tcaatcaccttcactctctcttcctccgttattcccg |
47728506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University