View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8500_high_19 (Length: 241)
Name: NF8500_high_19
Description: NF8500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8500_high_19 |
 |  |
|
| [»] scaffold0332 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0332 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: scaffold0332
Description:
Target: scaffold0332; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 19 - 222
Target Start/End: Original strand, 6125 - 6320
Alignment:
| Q |
19 |
cacagtttgtattttatgcacagactgcacctacacgatcattgctttctatggattcactttgcactatactta--gatagcagaaaatgattccccct |
116 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6125 |
cacagttcgtattttatgcacagactgcacctacacgatcattgctttctatggattcactttgcactatacttatagatagcagaaaatgattccccct |
6224 |
T |
 |
| Q |
117 |
gttattatatcagtccaagaaagaatatggacagtcattttcttctattgaattttcattccctttgttttctggtgtgcatgttttgcttcaaatgaag |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6225 |
gttattatatcagtccaagaaagaatatggacagtcattttcttctattgaattttcattccctt----------tgtgcatgttttgcttcaaatgaag |
6314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University