View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8500_high_20 (Length: 238)
Name: NF8500_high_20
Description: NF8500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8500_high_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 112 - 222
Target Start/End: Complemental strand, 7506591 - 7506476
Alignment:
| Q |
112 |
tggtccataattgtaattaacaaga-----tgccgattcttctaaagtatgtacttgtccaaaccaatgtatttcgcccatccaagtgcctctaaaatag |
206 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7506591 |
tggtccataattgtaattaacaagacaagatgccgattcttctaaagtatgtatttgtccaaaccaatgtatttcgcccatccaagtgcctctaaaatag |
7506492 |
T |
|
| Q |
207 |
tttacatttgaagatt |
222 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
7506491 |
tttacatttgaagatt |
7506476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 7506817 - 7506754
Alignment:
| Q |
1 |
agttataaatagagaggatcttaaccccttttttataccaaatcaagagacacagttctcttag |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7506817 |
agttataaatagagaggatcttaaccccttttttataccaaatcaagcaacacagttctcttag |
7506754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University