View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8500_high_24 (Length: 220)
Name: NF8500_high_24
Description: NF8500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8500_high_24 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 54827706 - 54827499
Alignment:
| Q |
1 |
ccaccgtaagcaacgctaccataggtgccaaaaccagctgaacctgaacctgaacctgaacctgctgcagttggaggattattattagttgtggtagtgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
54827706 |
ccaccgtaagcaacgctaccataggtgccaaaaccagctgaacctgaacctg------------ctgcagttggaggattattatgagttgtggtagtgg |
54827619 |
T |
 |
| Q |
101 |
ttgctacaccggtgagatggatagggtttccatgttcgtcagttaacttaactgggttacccaattcatcagttagttgaattgggtttccatgttcgtc |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54827618 |
ttgctacaccggtgagatggatcgggtttccatgttcgtcagttaacttaactgggttacccaattcatcagttagttgaattgggtttccatgttcgtc |
54827519 |
T |
 |
| Q |
201 |
tcttatttgcactcccgcca |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
54827518 |
tcttatttgcactcccgcca |
54827499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University