View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8500_low_22 (Length: 314)
Name: NF8500_low_22
Description: NF8500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8500_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 295
Target Start/End: Original strand, 36060632 - 36060927
Alignment:
| Q |
1 |
catgcaagtacttaataannnnnnnngcttttcatcatgctaatgcatgtttcagttccacactcatctctctatcttccccgttaaagtagcttttctg |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36060632 |
catgcaagtacttaataattttttttgcttttcatcatgctaatgcatgtttcagttccacactcatctctctatcttccccgttaaagtagcttttctg |
36060731 |
T |
|
| Q |
101 |
tcttagcacttttaggcaagcaggtgataatgttttattctctcgaagttaataaaggacatgaccaaaagctgtttgttgtctctccgaatcattctct |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
36060732 |
tcttagcacttttaggcaagcaggtaataatgttttattctctcgaagttaataaaggacatgaccaaaagctgtttattgtctctcagaatcattctct |
36060831 |
T |
|
| Q |
201 |
tgatcgatataataaggctgtacttgtacccccgggaccattgttaa-gattctaaattatgaaaatacaaattttcataaaaatttaccacttaa |
295 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||| ||||||||||| |||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
36060832 |
tgatcgatataataaggttgtacttgtaccaccggaaccattgttaaggattctaaattatgaaaatataaattttcatacaaatttaccacttaa |
36060927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University