View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8500_low_24 (Length: 293)
Name: NF8500_low_24
Description: NF8500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8500_low_24 |
 | |
|
| [»] scaffold0125 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 1 - 278
Target Start/End: Original strand, 15148539 - 15148816
Alignment:
| Q |
1 |
aattaattgcatattttcagaactaaaacaaatcatcaaccttgaagagcaatagcatattctaactaaatactttggaaacacaaatcaccttaagatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15148539 |
aattaattgcatattttcagaactaaaacaaatcatcaaccttgaagagcaatagcatattctaactaaatactttggaaacacagatcaccttaagatt |
15148638 |
T |
|
| Q |
101 |
cacaagtccctacaaatacaatactctttttattacgacgatatattcataccttgatataaattgtttgtcttctcaaagattctgacttaattaagtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15148639 |
cacaagtccctacaaatacaatactctttttattacgacgatatattcataccttgatataaattgcttgtcttctcaaagattctgacttaattaagtc |
15148738 |
T |
|
| Q |
201 |
atttgaggaatcaagttttactactagaaaaagttgatatgttgacgaaatttagagaaggaatctctttatcaatat |
278 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15148739 |
atttgaggaatcaacttttactactagaaaaagttgatatgttgacgaaatttagagaaggaatctctttatcaatat |
15148816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0125 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0125
Description:
Target: scaffold0125; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 220 - 263
Target Start/End: Complemental strand, 23107 - 23064
Alignment:
| Q |
220 |
actactagaaaaagttgatatgttgacgaaatttagagaaggaa |
263 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
23107 |
actactagaaaaagttgatatactgacgaaatttagagacggaa |
23064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University