View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8500_low_28 (Length: 247)
Name: NF8500_low_28
Description: NF8500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8500_low_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 41078568 - 41078341
Alignment:
| Q |
1 |
caatgtatggatggttagttttgtgagacaaatcaaatataggtttcatcttattattgcactcaaannnnnnnnnnnnggttaaactatgctacgctaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41078568 |
caatgtatggatggttagttttgtgagacaaatcaaatataggtttcatcttattattgcactcaaatttttcttttttggttaaactatgctacgctaa |
41078469 |
T |
|
| Q |
101 |
atatatatttttcctggttgtagatatggtattctatatgaattatgactttcactaaactatttggatcctattggagaagcagagaataggaacannn |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41078468 |
atatatatttttcctggttgtagatatggtattctatatgaattttgactttcactaaactatttggatcctattggagaagcagagaataggaacattt |
41078369 |
T |
|
| Q |
201 |
nnnnctgttgtatttcagttacctagct |
228 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
41078368 |
ttttctgttgtatttcagttacctagct |
41078341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University