View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8501_high_18 (Length: 239)
Name: NF8501_high_18
Description: NF8501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8501_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 34715324 - 34715546
Alignment:
| Q |
1 |
cttcgccggagaacaagaaggttcagatttatacgatttgagaagctcgtctgcttcttgaagctgtgtacggtaatgaaccgtaaatgcttgtaactcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34715324 |
cttcgccggagaacaagaaggttcagatttatacgatttgagaagctcgtctgcttcttgaagctgtgtacggtaatgaaccgtaaatgcttgtaactcc |
34715423 |
T |
 |
| Q |
101 |
ggtgcgtctttgagaacggtttgaacccatttaggatcttcttcgagaaagagtgtttttccctgtgggttgaacccggcccacatgagtgaatcgtgac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34715424 |
ggtgcgtctttgagaacggtttgaacccatttaggatcttcttcgagaaagagtgtttttccctgtgggttgaacccggcccacatgagtgaatcgtgac |
34715523 |
T |
 |
| Q |
201 |
ctagaccgaatacgaggaagttg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
34715524 |
ctagaccgaatacgaggaagttg |
34715546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 99 - 144
Target Start/End: Complemental strand, 38533040 - 38532995
Alignment:
| Q |
99 |
ccggtgcgtctttgagaacggtttgaacccatttaggatcttcttc |
144 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38533040 |
ccggtgcatctttaagaacggtttgaacccatttaggatcttcttc |
38532995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University