View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8501_high_23 (Length: 217)
Name: NF8501_high_23
Description: NF8501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8501_high_23 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 40 - 217
Target Start/End: Original strand, 5294973 - 5295151
Alignment:
| Q |
40 |
ttaggcaggtatggtttgatataagtcaatatggtttaggtgttagatcagaaatgcaatggggttt-ctatgaatgataattaccaattagattagtta |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5294973 |
ttaggcaggtatggtttgatataagtcaatatggtttaggtgttagatcagaaatgcaatggggttttctatgaatgataattaccaattagattagtta |
5295072 |
T |
 |
| Q |
139 |
attaactggcttaatcggaaatgtaaatagtttatttattgtaattttgcaagtatttggtgttcttgttatgctttta |
217 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5295073 |
attaactggcttaatcagaaatgtaaatagtttatttattgtaattttgcaagtatttggtgttcttgttatgctttta |
5295151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University