View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8501_low_23 (Length: 279)
Name: NF8501_low_23
Description: NF8501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8501_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 266
Target Start/End: Complemental strand, 30514298 - 30514033
Alignment:
| Q |
1 |
aatgaatttggttcagagaagcattgggacaaaaattgaatgccnnnnnnnacaagttattaggattgtacgatcttttcagaggttcactagcacttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30514298 |
aatgaatttggttcagagaagcattgggacaaaaattgaatgcctttttttacaagttattaggattgtacgatcttttcagaggttcactagcacttct |
30514199 |
T |
|
| Q |
101 |
accaaacagtaaccacaagatttaagggcaacaaacaacgtagtaactgtaccactttctgttcatatattcttttcaaaaatccttagcttttcttgtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30514198 |
accaaacagtaaccacaagatttaagggcaacaaacaacgtagtaactgtacctgtttctgttcatatattcttttcaaaaatccttaccttttcttgtt |
30514099 |
T |
|
| Q |
201 |
tttacacaactgttccttctgccactaaaaaatataacactagcagttctttctacttttgtttat |
266 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30514098 |
tttacaccactgttccttctgccactaaaaaatataacactagcagttctttctacttttgtttat |
30514033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University