View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8501_low_26 (Length: 259)
Name: NF8501_low_26
Description: NF8501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8501_low_26 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 16 - 259
Target Start/End: Original strand, 31234821 - 31235064
Alignment:
| Q |
16 |
gtgagaagaaatgcacttaggaacatcatttaggtagttccagtttttgtacaaatcttggttgcttctgtcgtttatccactgcaaaacatatggcaaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31234821 |
gtgagaagaaatgcacttaggaacatcatttaggtagttccagtttttgcacaaatcttggttgcttctgtcgtttatccactgcaaaacatatggcaaa |
31234920 |
T |
|
| Q |
116 |
ataagatttacgaaacataagcaaagaaaataacctnnnnnnnncattccacaaacataagtaacctgttcaatagtaatatcttgaagcttgtggcaat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31234921 |
ataagatttacgaaacataagcaaagaaaataacctaaaagaaacattccacaaacataagtaacctgttcaatagtaatatcttgaagattgtggcaat |
31235020 |
T |
|
| Q |
216 |
tttgaagcacttccattacattgtcccaatgataaaattcatac |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31235021 |
tttgaagcacttccattacattgtcccaatgataaaattcatac |
31235064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University