View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8501_low_31 (Length: 255)
Name: NF8501_low_31
Description: NF8501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8501_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 20 - 177
Target Start/End: Original strand, 40360364 - 40360521
Alignment:
| Q |
20 |
cactgtcagcactacgtgatttttggtgcatgacaacaatgtttgaactcttacattcttcttcttcctcttccttccttgtatcagcttcggtgcaata |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40360364 |
cactgtcagcactacgtgatttttggtgcatgacaacaatgtttgaactcttacattcttcttcttcctcttccttccttgtatcagcttcggtgcaata |
40360463 |
T |
 |
| Q |
120 |
aattctgaaactcggagatccttggtataaaaatcttccgacttcgtcgtcgtcgtcg |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
40360464 |
aattctgaaactcggagatccttggtataaaaatcttccaacttcatcgtcgtcgtcg |
40360521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University