View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8501_low_38 (Length: 237)
Name: NF8501_low_38
Description: NF8501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8501_low_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 13 - 220
Target Start/End: Complemental strand, 53918754 - 53918547
Alignment:
| Q |
13 |
aagaaaacaaagtgtaaagaatggataacctccagtttggttcatattttagtgggtggttttggagctttatttaaaggaacactcaagttgtatttgt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53918754 |
aagaaaacaaagtgtaaagaatggataacctccagtttggttcatattttagtgggtggttttggagctttatttaaaggaacactcaagttgtatttgt |
53918655 |
T |
 |
| Q |
113 |
aagagatatacaagaagccatacttcttatgaaggtgctttggatcaacagggaacctttttgctagatgtattttgccatcggaaatggttctatgtta |
212 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53918654 |
aagagatatacaagaagtcatgcttcttatgaaggtgctttggatcaacagggaacctttttgctagatgtattttgccatcggaaatggttctatgtta |
53918555 |
T |
 |
| Q |
213 |
agtagttg |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
53918554 |
agtagttg |
53918547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University