View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8502_high_5 (Length: 259)
Name: NF8502_high_5
Description: NF8502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8502_high_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 230; Significance: 1e-127; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 9 - 242
Target Start/End: Complemental strand, 29606034 - 29605801
Alignment:
| Q |
9 |
tcgtggtcgagggtttgttagaaataggagaggttgctgctggtggttgctttgtactactagcaggagttgctgctacaataggcttttgtttgtctag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29606034 |
tcgtggtcgagggtttgttagaaataggagaggttgctgctggtggttgctttgtactactagcaggagttgctgctacaataggcttttgtttgtctag |
29605935 |
T |
|
| Q |
109 |
gggcaatgtggaaggtgcagatggattcgttgttggcaacttcgatggtgcagctgccgtgactgtggttatgggtttgttagaagtaggagaagttgct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29605934 |
gggcaatgtggaaggtgcagatggattcgttgttggcaacttcgatggtgcagctgccgtgactgtggttatgggtttgttagaagtaggagaagttgct |
29605835 |
T |
|
| Q |
209 |
gcaggttgtttgtttgtattactaacaggagttg |
242 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
29605834 |
gcaggttgtttgtttgtattactagcaggagttg |
29605801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 59 - 210
Target Start/End: Complemental strand, 29605777 - 29605626
Alignment:
| Q |
59 |
tttgtactactagcaggagttgctgctacaataggcttttgtttgtctaggggcaatgtggaaggtgcagatggattcgttgttggcaacttcgatggtg |
158 |
Q |
| |
|
|||||| |||||||||||||||| || |||||||||| |||||||| || |||| ||| || ||| | |||||||| || ||||||||||||||||||| |
|
|
| T |
29605777 |
tttgtattactagcaggagttgcagccacaataggctgttgtttgtataatggcagtgttgatggttccgatggatttgtggttggcaacttcgatggtg |
29605678 |
T |
|
| Q |
159 |
cagctgccgtgactgtggttatgggtttgttagaagtaggagaagttgctgc |
210 |
Q |
| |
|
||||||||||||| |||| | ||||||||||||||||||||||| ||||||| |
|
|
| T |
29605677 |
cagctgccgtgaccgtggctgtgggtttgttagaagtaggagaaattgctgc |
29605626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 19 - 104
Target Start/End: Complemental strand, 29605862 - 29605777
Alignment:
| Q |
19 |
gggtttgttagaaataggagaggttgctgctggtggttgctttgtactactagcaggagttgctgctacaataggcttttgtttgt |
104 |
Q |
| |
|
||||||||||||| ||||||| |||||||| ||| ||| |||||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
29605862 |
gggtttgttagaagtaggagaagttgctgcaggttgtttgtttgtattactagcaggagttgctgccacaataggctgttgtttgt |
29605777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University