View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8502_low_14 (Length: 257)
Name: NF8502_low_14
Description: NF8502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8502_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 4112374 - 4112137
Alignment:
| Q |
1 |
ataatgatcatgagaccgacacatgtgattatatttaatcaataatcacttccatatacttaaaactattcattataaaaattgtctttgtttcatgcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
4112374 |
ataatgatcatgagaccgacacatgtgattatatttaatcaataatcacttccatatacttaaaactat-cattataaaaattgtctgtgtttcatgcaa |
4112276 |
T |
 |
| Q |
101 |
tagaatatgataaatcaaaacagaggaaaaaacaatcaaagtaaatgaaaacagaacactcaccatacaatgcatctcccttttctgcatgatcaaattc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4112275 |
tagaatatgataaatcaaaacagaggaaaaaacaatcaaagtaaatgaaaacagaacactcaccatacaatgcatctcccttttctgcatgatcaaattc |
4112176 |
T |
 |
| Q |
201 |
tgaaggaggactcacaatagggtgcagcaccactcttcc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4112175 |
tgaaggaggactcacaatagggtgcagcaccactcttcc |
4112137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 204
Target Start/End: Complemental strand, 30901526 - 30901480
Alignment:
| Q |
158 |
actcaccatacaatgcatctcccttttctgcatgatcaaattctgaa |
204 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||| |||||| |
|
|
| T |
30901526 |
actcaccatttaatgcatcacccttttctgcatgatcaaactctgaa |
30901480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University