View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8502_low_15 (Length: 250)
Name: NF8502_low_15
Description: NF8502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8502_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 4112368 - 4112485
Alignment:
| Q |
1 |
tcattatgcattagacaccaaacacgttctcgatctgcagtgtcgatgctacatcataaataaataatatttgcacgttcaatgttaaaagcctttaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4112368 |
tcattatgcattagacaccaaacacgttctcgatctgcagtgtcgatgctacatcataaataaataatatttgcacgttcaatgttaaaagcctttaatt |
4112467 |
T |
|
| Q |
101 |
atttatgctgactcttac |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
4112468 |
atttatgctgactcttac |
4112485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 152 - 240
Target Start/End: Original strand, 4112520 - 4112608
Alignment:
| Q |
152 |
gattcagccatggaattggctctgtctttggagaagttagtaaatgagaaacttctgaatgttcacagtgtaatgcctctttctctctg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4112520 |
gattcagccatggaattggctctgtctttggagaagttagtaaatgagaaacttctgaatgttcacagtgtaatgcctctttctctctg |
4112608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 161 - 233
Target Start/End: Complemental strand, 25792934 - 25792862
Alignment:
| Q |
161 |
atggaattggctctgtctttggagaagttagtaaatgagaaacttctgaatgttcacagtgtaatgcctcttt |
233 |
Q |
| |
|
|||||||| ||| ||||||||||||||||| |||||| |||||||||||||| || |||||||||||||||| |
|
|
| T |
25792934 |
atggaattagctttgtctttggagaagttaacaaatgaaaaacttctgaatgtgcatagtgtaatgcctcttt |
25792862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University