View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8502_low_18 (Length: 239)
Name: NF8502_low_18
Description: NF8502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8502_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 3 - 224
Target Start/End: Complemental strand, 30855737 - 30855521
Alignment:
| Q |
3 |
tttagatttttaaagtttattttgaaaaataattttttatcaccaaagttaccgttgagttgaatcgcgacgatactgttctctttaagatgtttggtga |
102 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||| |||||||||||| |||||||||||||||| ||| |||||| ||||||||||||| || |
|
|
| T |
30855737 |
tttagatttttaaagtttattttgaaaaagaaatttttaccaccaaagttactactgagttgaatcgcgaccatattgttctttttaagatgtttgtcga |
30855638 |
T |
 |
| Q |
103 |
gagtacttttttaaaattgtgcaagctagactatatatcaaccatagctactctataataaaactagttcagttacaattgtatgattaaaaactacatt |
202 |
Q |
| |
|
|| |||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
30855637 |
cggtggtttttt-aaattgtgcaagctagac----tatcaaccatagctactctataataaaactagttcagttacaactgtatgattaaacactacatt |
30855543 |
T |
 |
| Q |
203 |
gtagctaatcgttcgagaatat |
224 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
30855542 |
gtagctaatcgttcgagaatat |
30855521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University