View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8502_low_19 (Length: 216)

Name: NF8502_low_19
Description: NF8502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8502_low_19
NF8502_low_19
[»] chr7 (1 HSPs)
chr7 (10-194)||(36529177-36529361)


Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 10 - 194
Target Start/End: Original strand, 36529177 - 36529361
Alignment:
10 atggacatcagtagattttgctctactatgattttacttacattcataaaatgataaagctcattttttgggggagtgatgggctagataaacttccaaa 109  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36529177 atggacaccagtagattttgctctactatgattttacttacattcataaaatgataaagctcattttttgggggagtgatgggctagataaacttccaaa 36529276  T
110 gagatgaactacgaaatcaatgttcagcatggttgcttgtccttcaatcaatttctttagtgctatagcatatcatcattcattc 194  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36529277 gagatgaactacgaaatcaatgttcagcatggttgcttgtccttcaatcaatttctttagtgctatagcatatcatcattcattc 36529361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University