View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8502_low_19 (Length: 216)
Name: NF8502_low_19
Description: NF8502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8502_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 10 - 194
Target Start/End: Original strand, 36529177 - 36529361
Alignment:
| Q |
10 |
atggacatcagtagattttgctctactatgattttacttacattcataaaatgataaagctcattttttgggggagtgatgggctagataaacttccaaa |
109 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36529177 |
atggacaccagtagattttgctctactatgattttacttacattcataaaatgataaagctcattttttgggggagtgatgggctagataaacttccaaa |
36529276 |
T |
|
| Q |
110 |
gagatgaactacgaaatcaatgttcagcatggttgcttgtccttcaatcaatttctttagtgctatagcatatcatcattcattc |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36529277 |
gagatgaactacgaaatcaatgttcagcatggttgcttgtccttcaatcaatttctttagtgctatagcatatcatcattcattc |
36529361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University