View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8503_high_23 (Length: 300)
Name: NF8503_high_23
Description: NF8503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8503_high_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 16 - 285
Target Start/End: Original strand, 30196737 - 30197006
Alignment:
| Q |
16 |
aatagaagagtttatgtctttctgattttgagttcagtttgtttggtattgtgatgtgtgatttatagaaacgtgatttagtcacggaaacgcgtttttt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30196737 |
aatagaagagtttatgtctttctgattttgagttcagtttgtttggtattgtgatgtgtgatttatagaaacgtgatttggtcacggaaacgcgtttttt |
30196836 |
T |
 |
| Q |
116 |
aggtaaaaagttgaagnnnnnnngagaaatattgaggtggattaattacaaacgcggtttttgagtgaagtgaaagtgaaatgttatgtttgggagtgaa |
215 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30196837 |
aggtaaaaagttgaagaaaaaaagagaaatattgaggtggaataattacaaacgcggtttttgagtgaagtgaaagtgaaatgttatgtttgggagtgaa |
30196936 |
T |
 |
| Q |
216 |
ggaaagtagatactatgatatacaccacaagaaaacaggaagcgtgttttgaattatggttggaagttgg |
285 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30196937 |
ggaaagtagatactatgataaacaccacaagaaaacaggaagcgtgttttgaattatggttggaagttgg |
30197006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University