View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8503_high_33 (Length: 243)

Name: NF8503_high_33
Description: NF8503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8503_high_33
NF8503_high_33
[»] chr5 (34 HSPs)
chr5 (71-241)||(2606249-2606419)
chr5 (69-241)||(37030516-37030687)
chr5 (69-241)||(16513861-16514032)
chr5 (69-239)||(37883126-37883298)
chr5 (69-240)||(12723370-12723540)
chr5 (73-241)||(26278744-26278910)
chr5 (69-241)||(27114003-27114174)
chr5 (1-72)||(2606681-2606752)
chr5 (69-241)||(12784853-12785024)
chr5 (73-171)||(9715629-9715727)
chr5 (92-241)||(25977393-25977541)
chr5 (69-241)||(18808678-18808849)
chr5 (69-228)||(13822353-13822510)
chr5 (69-240)||(8197107-8197277)
chr5 (69-167)||(5344073-5344171)
chr5 (69-172)||(1711545-1711648)
chr5 (69-136)||(29047387-29047454)
chr5 (69-134)||(6432775-6432840)
chr5 (121-238)||(8301033-8301149)
chr5 (71-131)||(37094246-37094306)
chr5 (73-147)||(8551260-8551334)
chr5 (184-241)||(37012642-37012699)
chr5 (184-237)||(38679724-38679777)
chr5 (189-241)||(9715575-9715626)
chr5 (69-136)||(37012565-37012632)
chr5 (111-240)||(3556362-3556490)
chr5 (69-150)||(13654681-13654762)
chr5 (208-241)||(27948429-27948462)
chr5 (71-172)||(31471796-31471897)
chr5 (209-241)||(1711478-1711510)
chr5 (209-241)||(5344001-5344033)
chr5 (73-133)||(11720287-11720347)
chr5 (209-241)||(32746682-32746714)
chr5 (69-125)||(38692236-38692292)
[»] chr3 (30 HSPs)
chr3 (78-241)||(39353013-39353175)
chr3 (73-241)||(41193984-41194151)
chr3 (71-241)||(31765464-31765634)
chr3 (111-241)||(6936216-6936346)
chr3 (69-238)||(32529504-32529673)
chr3 (60-241)||(149017-149197)
chr3 (69-241)||(10509489-10509660)
chr3 (69-241)||(39586272-39586443)
chr3 (69-241)||(40936916-40937087)
chr3 (73-232)||(49166380-49166538)
chr3 (69-171)||(53814650-53814752)
chr3 (73-241)||(227334-227499)
chr3 (69-167)||(47375059-47375157)
chr3 (121-241)||(41174571-41174689)
chr3 (69-171)||(36403016-36403118)
chr3 (69-167)||(49440601-49440699)
chr3 (184-241)||(47646728-47646785)
chr3 (71-131)||(8735734-8735794)
chr3 (71-131)||(9087975-9088035)
chr3 (69-167)||(16481094-16481191)
chr3 (71-117)||(18875737-18875783)
chr3 (69-167)||(44207920-44208018)
chr3 (208-241)||(3733787-3733820)
chr3 (208-241)||(26982586-26982619)
chr3 (209-241)||(9126872-9126904)
chr3 (209-241)||(9134979-9135011)
chr3 (209-241)||(21450422-21450454)
chr3 (209-241)||(49327575-49327607)
chr3 (209-241)||(49440529-49440561)
chr3 (208-240)||(53393788-53393820)
[»] chr4 (42 HSPs)
chr4 (69-241)||(45924303-45924474)
chr4 (72-241)||(16451638-16451806)
chr4 (73-238)||(38551533-38551697)
chr4 (71-240)||(15543103-15543272)
chr4 (69-241)||(35320157-35320328)
chr4 (69-241)||(4190136-4190307)
chr4 (69-241)||(28311153-28311324)
chr4 (69-241)||(49374023-49374194)
chr4 (69-239)||(35158417-35158587)
chr4 (69-239)||(45228789-45228958)
chr4 (69-241)||(52417201-52417371)
chr4 (69-233)||(2016062-2016224)
chr4 (69-241)||(45029288-45029459)
chr4 (69-229)||(9036379-9036537)
chr4 (69-241)||(28781038-28781209)
chr4 (69-241)||(40727724-40727895)
chr4 (71-241)||(51538346-51538515)
chr4 (145-241)||(6963235-6963330)
chr4 (78-172)||(168879-168973)
chr4 (111-241)||(43842145-43842274)
chr4 (69-205)||(45458040-45458175)
chr4 (183-241)||(4047951-4048008)
chr4 (183-241)||(38218535-38218593)
chr4 (73-131)||(42660144-42660202)
chr4 (83-212)||(27283651-27283779)
chr4 (69-241)||(16023572-16023743)
chr4 (121-241)||(30003362-30003481)
chr4 (157-241)||(56463909-56463992)
chr4 (82-241)||(31092818-31092976)
chr4 (69-167)||(40693314-40693412)
chr4 (145-230)||(33280862-33280946)
chr4 (73-136)||(17646902-17646965)
chr4 (71-125)||(54630936-54630990)
chr4 (69-167)||(55614182-55614279)
chr4 (69-126)||(33280802-33280859)
chr4 (211-240)||(53269245-53269274)
chr4 (69-238)||(55136365-55136533)
chr4 (209-241)||(13721187-13721219)
chr4 (209-241)||(16684506-16684538)
chr4 (209-241)||(38990912-38990944)
chr4 (209-241)||(45659774-45659806)
chr4 (209-241)||(51888950-51888982)
[»] chr8 (21 HSPs)
chr8 (69-241)||(29544105-29544274)
chr8 (69-241)||(43098807-43098977)
chr8 (69-241)||(20091266-20091437)
chr8 (101-241)||(23144370-23144508)
chr8 (95-241)||(13546451-13546596)
chr8 (95-241)||(13677877-13678022)
chr8 (69-241)||(8240255-8240426)
chr8 (69-241)||(6347000-6347171)
chr8 (69-232)||(40105525-40105687)
chr8 (73-241)||(32337516-32337683)
chr8 (71-171)||(37098099-37098199)
chr8 (69-241)||(39318863-39319034)
chr8 (73-238)||(586676-586841)
chr8 (69-167)||(12060-12158)
chr8 (73-243)||(627081-627252)
chr8 (72-142)||(42132231-42132301)
chr8 (69-125)||(9074190-9074246)
chr8 (71-123)||(24628121-24628173)
chr8 (102-241)||(35684283-35684420)
chr8 (183-241)||(39260560-39260618)
chr8 (69-125)||(40995319-40995375)
[»] chr7 (17 HSPs)
chr7 (69-241)||(43457886-43458057)
chr7 (69-238)||(46254565-46254733)
chr7 (71-241)||(14816914-14817082)
chr7 (71-241)||(15263910-15264078)
chr7 (69-241)||(34848142-34848313)
chr7 (78-240)||(25529372-25529533)
chr7 (183-241)||(43270074-43270132)
chr7 (73-241)||(35794180-35794347)
chr7 (69-241)||(36312349-36312518)
chr7 (69-134)||(26791699-26791764)
chr7 (69-125)||(29332629-29332685)
chr7 (69-167)||(7255733-7255831)
chr7 (69-167)||(15032875-15032973)
chr7 (69-166)||(108407-108504)
chr7 (209-241)||(15032803-15032835)
chr7 (209-241)||(37998511-37998543)
chr7 (69-125)||(42864545-42864601)
[»] chr6 (12 HSPs)
chr6 (69-241)||(9305225-9305396)
chr6 (71-232)||(31271051-31271210)
chr6 (69-232)||(31318228-31318390)
chr6 (69-167)||(303453-303551)
chr6 (69-173)||(31723203-31723307)
chr6 (71-167)||(34949237-34949333)
chr6 (69-103)||(438744-438778)
chr6 (70-108)||(18460465-18460503)
chr6 (209-241)||(480159-480191)
chr6 (69-125)||(2540114-2540170)
chr6 (69-125)||(7416444-7416500)
chr6 (71-167)||(29435803-29435899)
[»] chr1 (33 HSPs)
chr1 (73-241)||(49851417-49851584)
chr1 (98-241)||(52632619-52632761)
chr1 (69-241)||(14587611-14587782)
chr1 (69-241)||(29961096-29961267)
chr1 (71-241)||(44496187-44496356)
chr1 (73-241)||(38860386-38860552)
chr1 (69-241)||(42882857-42883028)
chr1 (69-232)||(3517852-3518014)
chr1 (69-238)||(22858457-22858625)
chr1 (69-234)||(41900556-41900719)
chr1 (73-241)||(50262189-50262355)
chr1 (69-241)||(11952683-11952848)
chr1 (92-241)||(12528174-12528321)
chr1 (69-238)||(44757802-44757969)
chr1 (72-241)||(48965159-48965327)
chr1 (69-241)||(33801061-33801232)
chr1 (120-241)||(23984298-23984418)
chr1 (69-167)||(5750127-5750225)
chr1 (157-241)||(37952087-37952170)
chr1 (183-241)||(12700811-12700869)
chr1 (69-167)||(18271972-18272070)
chr1 (69-167)||(18276626-18276724)
chr1 (73-241)||(27216506-27216674)
chr1 (209-241)||(7199738-7199770)
chr1 (73-136)||(6605971-6606034)
chr1 (69-132)||(41086119-41086182)
chr1 (69-132)||(41090887-41090950)
chr1 (69-167)||(12525239-12525336)
chr1 (69-167)||(22335235-22335333)
chr1 (209-241)||(18272110-18272142)
chr1 (209-241)||(18276764-18276796)
chr1 (69-125)||(32817250-32817306)
chr1 (73-137)||(50890246-50890310)
[»] chr2 (20 HSPs)
chr2 (69-241)||(13278394-13278569)
chr2 (73-241)||(7943004-7943169)
chr2 (69-241)||(38707482-38707653)
chr2 (73-241)||(18137299-18137464)
chr2 (73-238)||(31994342-31994505)
chr2 (69-238)||(45116784-45116951)
chr2 (69-241)||(15911482-15911653)
chr2 (69-136)||(17138042-17138109)
chr2 (71-136)||(24167093-24167158)
chr2 (69-167)||(5464715-5464813)
chr2 (77-167)||(43333528-43333618)
chr2 (69-241)||(38207189-38207354)
chr2 (190-232)||(1210202-1210244)
chr2 (183-241)||(6402695-6402753)
chr2 (72-125)||(9846976-9847029)
chr2 (208-241)||(18963186-18963219)
chr2 (183-219)||(1114578-1114614)
chr2 (209-241)||(15113603-15113635)
chr2 (209-241)||(34948324-34948356)
chr2 (209-241)||(43333658-43333690)
[»] scaffold1301 (2 HSPs)
scaffold1301 (69-136)||(1373-1439)
scaffold1301 (183-241)||(1473-1531)
[»] scaffold0168 (1 HSPs)
scaffold0168 (69-136)||(11902-11969)


Alignment Details
Target: chr5 (Bit Score: 123; Significance: 3e-63; HSPs: 34)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 71 - 241
Target Start/End: Complemental strand, 2606419 - 2606249
Alignment:
71 tattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgatt 170  Q
    ||||||||||||||||||  |||||||||||||| | || ||||||| |||||||||||||||||| |||||||||||| ||||||||||||||||||||    
2606419 tattacttttcccaccttaatgccttctcgcgcgccttccaaaatttccaaaaatacccctggtccgaattatataatctggtccggattgttagtgatt 2606320  T
171 ttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||||  |||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||    
2606319 ttccggaacattaaatctggacaagatgttatgtgcttttttgtgtctttctttgatgtcaatggtctctg 2606249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 69 - 241
Target Start/End: Complemental strand, 37030687 - 37030516
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||| ||||| ||||||||||||||| |||||  ||||||| ||||| ||||||||||||  |||||||||||||| || ||||||||||||    
37030687 actattactttttccaccatgctgccttctcgcgtgtcctgcaaaatttccaaaagtacccctggtccggattatataatccggaccagattgttagtga 37030588  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
     | |||  || |  ||||| |||||||||||| || |||||||||||||||||||||||||||| ||||||||    
37030587 -tatccggaaaacaaaatccggaccagatgttatgcgcttttttgtgtctttctttgatgtcaagggtctctg 37030516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 69 - 241
Target Start/End: Complemental strand, 16514032 - 16513861
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||||||||| ||||||||||||||||| |||  ||||||| ||||||||||  || |||  |||| |||||||||  | ||||||||||||    
16514032 actattacttttcccaccctgctgccttctcgcgcgccctgcaaaatttccaaaaatacctttgatccggattacataatccggatcagattgttagtga 16513933  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||||| | ||||  ||||| |||||| ||||| |||  |||| ||||||||||||||||||||| ||||||||    
16513932 ttttcgaaaaca-gaaatccggaccatatgttatgtaattttctgtgtctttctttgatgtcaagggtctctg 16513861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 69 - 239
Target Start/End: Original strand, 37883126 - 37883298
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||| ||||| |  |||||||||||||| |||  |||||||||||||||| || ||||||  |||||||||| ||| || ||||||||||||    
37883126 actattactttttccaccctattgccttctcgcgcgccctgcaaaattttcaaaaataaccatggtccggattatataatgcggaccagattgttagtga 37883225  T
169 tt--ttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctc 239  Q
    ||  |   | || |||||||| |||||||||| | ||||||||||||||| ||||||||||||||| ||||||    
37883226 tttctgaaaaaaaattaaatccggaccagatggtatgtgcttttttgtgtatttctttgatgtcaaaggtctc 37883298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 69 - 240
Target Start/End: Original strand, 12723370 - 12723540
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||||||||| |||||||| |||||||| |||  ||||||| | |||||||||||||| |  |||| |||||||||  | ||||||||||||    
12723370 actattacttttcccaccctgctgcctcctcgcgcgccctgcaaaatttactaaaatacccctggttcggattacataatccggatcagattgttagtga 12723469  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctct 240  Q
    ||| | | ||||  ||||| | |||||||||| |||  |||| ||||||||||||||||||||| |||||||    
12723470 tttccgaaaaca-gaaatccgaaccagatgttatgtaattttctgtgtctttctttgatgtcaagggtctct 12723540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 73 - 241
Target Start/End: Original strand, 26278744 - 26278910
Alignment:
73 ttacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgatttt 172  Q
    |||||||||| ||| || | |||||||||||| ||| |||||||| | ||||||||||||||||  |||||||||||||| || |||||||||||| | |    
26278744 ttacttttcctaccctgtttccttctcgcgcgccctgtaaaattt-ctaaaatacccctggtccggattatataatccggaccagattgttagtga-tat 26278841  T
173 ccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||  || |  ||||  |||||||||||| |||| |||||||||||||| |||||||||||  |||||||    
26278842 ccggaaaacgaaattcggaccagatgttatgtgtttttttgtgtctttttttgatgtcaagtgtctctg 26278910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 69 - 241
Target Start/End: Original strand, 27114003 - 27114174
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    ||||||| |||||||||  || |||||||| ||| ||| | ||||||||||||||||||| || |||  ||||||||| ||||| || ||||||||||||    
27114003 actattatttttcccactctgttgccttcttgcgtgtcttgtaaaattttcaaaaatacctcttgtctgaattatatattccggaccagattgttagtga 27114102  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||| |  || |  |||||  || ||||| || |||| |||||||||||||||||||||||||| ||||||||    
27114103 tttt-cggaatacgaaatccagatcagatattatgtgtttttttgtgtctttctttgatgtcaagggtctctg 27114174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 2606752 - 2606681
Alignment:
1 aacggattttgtatgaccggctcccctgaggaatcctaaacgtattatgcatttgacaaaatatgttcacta 72  Q
    ||||||||||||| |||||||||| || |||| |||||||||||||||||||||||||||||||||||||||    
2606752 aacggattttgtaagaccggctcctctaaggagtcctaaacgtattatgcatttgacaaaatatgttcacta 2606681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 69 - 241
Target Start/End: Original strand, 12784853 - 12785024
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||||||||| |||||||| |||||||  |||  |  |||| | |||||||||||||| |  |||| |||||||||  ||||| ||||||||    
12784853 actattacttttcccaccctgctgcctcctcgcgcaccctgcaccatttactaaaatacccctggttcggattacataatccggatcggatggttagtga 12784952  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||| | | ||||  ||||| | |||||||||| |||  |||| ||||||||||||||||||||| ||||||||    
12784953 tttccgaaaacag-aaatccgaaccagatgttatgtaattttctgtgtctttctttgatgtcaagggtctctg 12785024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 73 - 171
Target Start/End: Complemental strand, 9715727 - 9715629
Alignment:
73 ttacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgattt 171  Q
    ||||||||  |||| |||||||||||||||||||||  || |||||  |||||||||||||||| ||||||||||||| | || |||||||||||||||    
9715727 ttacttttttcaccctgctgccttctcgcgcgtcctgcaatatttttgaaaatacccctggtccgaattatataatccagaccagattgttagtgattt 9715629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 92 - 241
Target Start/End: Complemental strand, 25977541 - 25977393
Alignment:
92 gccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgattttccataacattaaatctgga 191  Q
    ||||||||||||| ||| |||||||| ||||||||||||||||    |||||||||||||   | |||||||||||||   ||  || |  ||||| |||    
25977541 gccttctcgcgcgccctgtaaaatttacaaaaatacccctggtttggattatataatccgtagcagattgttagtgatac-ccggaaaacgaaatcagga 25977443  T
192 ccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
     |||||||| |||| |||||||||||||||||||||||||| ||||||||    
25977442 tcagatgttatgtggttttttgtgtctttctttgatgtcaagggtctctg 25977393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 69 - 241
Target Start/End: Original strand, 18808678 - 18808849
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||||||||| |||||||| ||| |||| |||  ||||||| | ||||||||| ||||||| |||| |||||||||  | ||||||||||||    
18808678 actattacttttcccaccatgctgcctcctcacgcgccctgcaaaatttactaaaatacccttggtccagattacataatccggatcagattgttagtga 18808777  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
     ||||   ||    ||||  |||||||||||| |||  |||  ||||||||||||||||||||| ||||||||    
18808778 -tttctggaaatagaaattcggaccagatgttatgtaatttcctgtgtctttctttgatgtcaagggtctctg 18808849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 69 - 228
Target Start/End: Complemental strand, 13822510 - 13822353
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    ||||||||||||||||||||||||||| |||||||| |||  ||||||| | ||||||||||||||||  ||||  |||||||| |  ||| |||||||     
13822510 actattacttttcccaccttgctgcctcctcgcgcgccctgcaaaatttactaaaatacccctggtccggattacgtaatccggactagatagttagtg- 13822412  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatg 228  Q
    ||||| | ||||  |||||  ||||||||||| |||  ||||  ||||||||||||||||    
13822411 ttttcaaaaaca-aaaatccagaccagatgttatgtaattttcggtgtctttctttgatg 13822353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 69 - 240
Target Start/End: Original strand, 8197107 - 8197277
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    ||||||||||||||||||  ||||||||||||| ||  ||  ||||||| | |||||||| |||||    |||| ||||||||| || ||||||||||||    
8197107 actattacttttcccaccccgctgccttctcgcacgctctgcaaaatttactaaaatacctctggtttggattacataatccggaccagattgttagtga 8197206  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctct 240  Q
    ||| |   |||| | | || |||  |||||| | ||  ||||||||||||||||||||||||||||||||||    
8197207 tttccggaaaca-tgattccggaaaagatgtatagtaattttttgtgtctttctttgatgtcaatggtctct 8197277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 69 - 167
Target Start/End: Complemental strand, 5344171 - 5344073
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtg 167  Q
    |||||||||||||||||| || |||||||||||||| |||  |||| || || |||||||||||||||  ||||  |||||||| || |||||||||||    
5344171 actattacttttcccaccatgttgccttctcgcgcgccctgcaaaaattccataaatacccctggtccggattacgtaatccggaccagattgttagtg 5344073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 69 - 172
Target Start/End: Complemental strand, 1711648 - 1711545
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||||||||| || ||||||||| |||| |||  |||| ||||| |||||||||||||||  ||||  ||||| || || |||||||||||     
1711648 actattacttttcccaccatgttgccttctcacgcgccctgcaaaaatttcataaatacccctggtccggattacgtaatcaggaccagattgttagtgt 1711549  T
169 tttt 172  Q
    ||||    
1711548 tttt 1711545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 69 - 136
Target Start/End: Complemental strand, 29047454 - 29047387
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtcc 136  Q
    |||||||||||||||||| || |||||||||||||| |||  |||| || ||||||||||||||||||    
29047454 actattacttttcccaccctgttgccttctcgcgcgccctgcaaaaattccaaaaatacccctggtcc 29047387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 69 - 134
Target Start/End: Complemental strand, 6432840 - 6432775
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggt 134  Q
    |||||||||||||||||| |  ||||||||||||||||||  |||| |||||||| ||||||||||    
6432840 actattacttttcccaccctcttgccttctcgcgcgtcctgcaaaaatttcaaaactacccctggt 6432775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 121 - 238
Target Start/End: Complemental strand, 8301149 - 8301033
Alignment:
121 aaaatacccctggtccaaattatataatccggtccggattgttagtgattttccataacattaaatctggaccagatgttttgtgcttttttgtgtcttt 220  Q
    ||||||||| | ||||  ||||||||||||||  | ||||||||||||||| | | ||||  ||||| | |||||||||| |||  |||| |||||||||    
8301149 aaaataccctttgtccggattatataatccggatcagattgttagtgatttccgaaaacag-aaatccgaaccagatgttatgtaattttctgtgtcttt 8301051  T
221 ctttgatgtcaatggtct 238  Q
    |||||||||||| |||||    
8301050 ctttgatgtcaagggtct 8301033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 71 - 131
Target Start/End: Original strand, 37094246 - 37094306
Alignment:
71 tattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccct 131  Q
    |||||||||||||||| || || ||||||||||| ||| |||||||||||||||| |||||    
37094246 tattacttttcccaccctgttgacttctcgcgcgccctgtaaaattttcaaaaatgcccct 37094306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 73 - 147
Target Start/End: Complemental strand, 8551334 - 8551260
Alignment:
73 ttacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataa 147  Q
    |||||||||||||| ||||||||||| || || |||  |||| ||||||||||| ||||| ||| ||||||||||    
8551334 ttacttttcccaccctgctgccttcttgcacgccctgcaaaaatttcaaaaatatccctgatccgaattatataa 8551260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 184 - 241
Target Start/End: Original strand, 37012642 - 37012699
Alignment:
184 aatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||| |||||||||||| ||| ||||| |||||||||||||||| |||| ||||||||    
37012642 aatccggaccagatgttatgtacttttctgtgtctttctttgatttcaaaggtctctg 37012699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 184 - 237
Target Start/End: Complemental strand, 38679777 - 38679724
Alignment:
184 aatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtc 237  Q
    |||| |||||||||||| |||  |||||||||||||||||||||||||| ||||    
38679777 aatccggaccagatgttatgtaattttttgtgtctttctttgatgtcaagggtc 38679724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 189 - 241
Target Start/End: Complemental strand, 9715626 - 9715575
Alignment:
189 ggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||||||||| || |||||||||||| |||||||||||||||||| ||||||||    
9715626 ggaccagat-ttatgtgcttttttgcgtctttctttgatgtcaagggtctctg 9715575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 69 - 136
Target Start/End: Original strand, 37012565 - 37012632
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtcc 136  Q
    ||||||| ||||| |||||||||||||| ||||||| |||  |||||||   ||||||||||||||||    
37012565 actattatttttctcaccttgctgccttttcgcgcgccctgcaaaatttattaaaatacccctggtcc 37012632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 111 - 240
Target Start/End: Original strand, 3556362 - 3556490
Alignment:
111 aaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgattttccataacattaaatctggaccagatgttttgtgctttt 210  Q
    ||||||| | |||||||||||||| |  ||||  || || || || |||||||||| |||||| | ||||  |||||  ||||||||||| |||   |||    
3556362 aaaatttactaaaatacccctggttcggattacttattctggaccagattgttagttattttcgaaaacag-aaatccagaccagatgttatgtaacttt 3556460  T
211 ttgtgtctttctttgatgtcaatggtctct 240  Q
     ||||||||||||||||||||| |||||||    
3556461 atgtgtctttctttgatgtcaaaggtctct 3556490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 69 - 150
Target Start/End: Original strand, 13654681 - 13654762
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatcc 150  Q
    |||||||||||||||| | ||||||||||||| ||    | |||||||| | |||||||||||||||   ||||||||||||    
13654681 actattacttttcccatcctgctgccttctcgtgcactatgtaaaatttactaaaatacccctggtctggattatataatcc 13654762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 208 - 241
Target Start/End: Original strand, 27948429 - 27948462
Alignment:
208 tttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||||||||||||||||||||||||| ||||||||    
27948429 tttttgtgtctttctttgatgtcaaaggtctctg 27948462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 71 - 172
Target Start/End: Complemental strand, 31471897 - 31471796
Alignment:
71 tattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgatt 170  Q
    |||||||||||||||  ||||||||||||||||| | |  |||| || || ||||| ||||||||| |||||| |  ||||  || ||||||||||| ||    
31471897 tattacttttcccactctgctgccttctcgcgcgccttgaaaaaattccacaaatatccctggtccgaattatgttttccgaaccagattgttagtgttt 31471798  T
171 tt 172  Q
    ||    
31471797 tt 31471796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Complemental strand, 1711510 - 1711478
Alignment:
209 ttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||||||||||||||||||||| ||||||||    
1711510 ttttgtgtctttctttgatgtcaagggtctctg 1711478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Complemental strand, 5344033 - 5344001
Alignment:
209 ttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||||||||||||||||||||| ||||||||    
5344033 ttttgtgtctttctttgatgtcaagggtctctg 5344001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 73 - 133
Target Start/End: Complemental strand, 11720347 - 11720287
Alignment:
73 ttacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctgg 133  Q
    |||||||||||||| | ||||||| ||||||| |||  ||||||| |||||||| ||||||    
11720347 ttacttttcccaccctactgccttttcgcgcgccctgcaaaatttacaaaaatatccctgg 11720287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Original strand, 32746682 - 32746714
Alignment:
209 ttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||||||||||||||||||||| ||||||||    
32746682 ttttgtgtctttctttgatgtcaagggtctctg 32746714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 125
Target Start/End: Original strand, 38692236 - 38692292
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaat 125  Q
    |||||||||||||||||| |   |||||||| |||| ||| ||||||||||||||||    
38692236 actattacttttcccaccatatggccttctcccgcgccctgtaaaattttcaaaaat 38692292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 30)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 78 - 241
Target Start/End: Original strand, 39353013 - 39353175
Alignment:
78 tttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgattttccata 177  Q
    ||||||||| ||||||||| ||||||| ||| |||||||||||||||||||||||||||  |||||||||||||| |  ||||||||||||||||| | |    
39353013 tttcccaccctgctgccttatcgcgcgccctgtaaaattttcaaaaatacccctggtccggattatataatccggacaagattgttagtgattttcga-a 39353111  T
178 acattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    | |||||||| |||||||||||| ||| ||||||||||||||||||||||||||||||||||||    
39353112 aaattaaatccggaccagatgttatgttcttttttgtgtctttctttgatgtcaatggtctctg 39353175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 73 - 241
Target Start/End: Complemental strand, 41194151 - 41193984
Alignment:
73 ttacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgatttt 172  Q
    |||||||||||||| ||||||||||||||||| ||   ||||||| | ||||||   |||||||  |||| ||||||||| || |||||||||||||||     
41194151 ttacttttcccaccctgctgccttctcgcgcgcccggcaaaatttactaaaatatttctggtccggattacataatccggaccagattgttagtgattt- 41194053  T
173 ccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||  || |  ||||| |||||||||||| |||| |||| ||||||||||||||||||||| ||||||||    
41194052 ccggaaaacgaaatcaggaccagatgttatgtgtttttatgtgtctttctttgatgtcaagggtctctg 41193984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 71 - 241
Target Start/End: Complemental strand, 31765634 - 31765464
Alignment:
71 tattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgatt 170  Q
    |||||||||| ||| ||||||||||||||||||| |||  |||||||||||||||| |||||||||  |||||||||| ||| ||  |||||||||||||    
31765634 tattactttttccatcttgctgccttctcgcgcgccctgcaaaattttcaaaaatatccctggtccggattatataattcggaccaaattgttagtgatt 31765535  T
171 ttccataacattaaatctggaccagat-gttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    | |   || || ||||| |||||| || ||| |||| |||||||||  ||||||||||||||| ||||||||    
31765534 t-ctggaaaatgaaatccggaccatattgttatgtgtttttttgtgcttttctttgatgtcaagggtctctg 31765464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 111 - 241
Target Start/End: Original strand, 6936216 - 6936346
Alignment:
111 aaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgattttccataacattaaatctggaccagatgttttgtgctttt 210  Q
    ||||||| |||||||||||||||||   |||||||||||||| || ||||||||||   |||||| || |  ||||  |||||||||||| |||| ||||    
6936216 aaaatttccaaaaatacccctggtcttgattatataatccggacccgattgttagtatgtttccagaaaacaaaattcggaccagatgttatgtgatttt 6936315  T
211 ttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||||||||||||||||||| ||||||||    
6936316 ttgtgtctttctttgatgtcaagggtctctg 6936346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 69 - 238
Target Start/End: Original strand, 32529504 - 32529673
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgtt-agtg 167  Q
    |||||||||||| ||||| ||||||||||||||| | ||| |||||||| | ||||||||||||||||  |||| ||||| ||| || ||||||| ||||    
32529504 actattactttttccaccctgctgccttctcgcgtgccctgtaaaatttactaaaatacccctggtccggattacataattcggaccagattgttaagtg 32529603  T
168 attttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtct 238  Q
    |||| |   ||||  ||||  |||||||||||| | ||||||| ||||||||||||||||||||| |||||    
32529604 atttccggaaaca-gaaattcggaccagatgttatatgcttttctgtgtctttctttgatgtcaagggtct 32529673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 60 - 241
Target Start/End: Original strand, 149017 - 149197
Alignment:
60 aatatgttcactattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggat 159  Q
    ||||| || |||||||||||| ||||| |||||||||||||||||||||  ||||||| | |||||| || |||||   ||||| |||||||| ||  ||    
149017 aatattttgactattactttttccaccctgctgccttctcgcgcgtcctgaaaaatttactaaaataaccatggtctggattatgtaatccggaccaaat 149116  T
160 tgttagtgattttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||||||||  |||||| ||    ||||| |||||||||||| |||  ||||||||||||||||||| |||||| ||||||||    
149117 tgttagtg-gtttccagaaacagaaatccggaccagatgttatgtaattttttgtgtctttctttgctgtcaagggtctctg 149197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 69 - 241
Target Start/End: Complemental strand, 10509660 - 10509489
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||| ||||| ||||||||||||||||  | |  ||||||| | ||||||| ||||||||  |||| |||||||||    ||||||||||||    
10509660 actattactttttccaccctgctgccttctcgcgccccttgcaaaatttactaaaatactcctggtccggattacataatccggattagattgttagtga 10509561  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||   ||||  | |||||||||||||||| |||  |||| ||||||||||||||||||||| ||||||||    
10509560 ttttcggaaacag-acatctggaccagatgttatgtaattttctgtgtctttctttgatgtcaagggtctctg 10509489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 69 - 241
Target Start/End: Original strand, 39586272 - 39586443
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||||||||| |  |||||||||||||| |||  ||||||||| |||||| ||||| |||  |||| |||||||   |  ||||||||||||    
39586272 actattacttttcccaccctattgccttctcgcgcgccctgcaaaattttctaaaataaccctgatccggattacataatccatacaagattgttagtga 39586371  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||| | | ||||  ||||| |||||||||||| |||  ||||   ||||||||||||||||||| ||||||||    
39586372 tttccgaaaaca-gaaatccggaccagatgttatgtaattttccatgtctttctttgatgtcaagggtctctg 39586443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 69 - 241
Target Start/End: Original strand, 40936916 - 40937087
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||||||||| | ||||||||||||||  ||| ||||||||   |||||| ||||||| || ||||| |||||||  || ||||||||||||    
40936916 actattacttttcccaccctactgccttctcgcgcaccctgtaaaatttattaaaataaccctggttcagattatgtaatccgaaccagattgttagtga 40937015  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    | | |   ||||  |||| ||||||||||||| |||  |||| |||||||||||||| | |||| ||||||||    
40937016 tatccggaaaca-gaaatatggaccagatgttatgtaattttctgtgtctttctttgctatcaagggtctctg 40937087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 73 - 232
Target Start/End: Complemental strand, 49166538 - 49166380
Alignment:
73 ttacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgatttt 172  Q
    |||||||||||||  || |||||||||||||| | |  ||||||| | |||||| || ||||||  |||| |||||| || || ||||||||||||||||    
49166538 ttacttttcccactatgttgccttctcgcgcgccttgcaaaatttactaaaatatccatggtccggattacataatctggaccagattgttagtgatttt 49166439  T
173 ccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaa 232  Q
      | || |  ||||| |||||||||||| |||| |||| |||||||||||||||||||||    
49166438 t-agaaaacgaaatccggaccagatgttatgtgtttttctgtgtctttctttgatgtcaa 49166380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 69 - 171
Target Start/End: Original strand, 53814650 - 53814752
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||||||||| |||||||||||||||||||||  ||||||| | |||||| |||||||||   ||| ||||| | | || ||||||||||||    
53814650 actattacttttcccaccctgctgccttctcgcgcgtcctgcaaaatttactaaaataaccctggtccgggttacataattcagaccagattgttagtga 53814749  T
169 ttt 171  Q
    |||    
53814750 ttt 53814752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 73 - 241
Target Start/End: Original strand, 227334 - 227499
Alignment:
73 ttacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgatttt 172  Q
    |||||||||||||| |||||||| |||||| | | |  ||||||| | ||||||| ||||||||  |||| ||||||||| |   ||||||||||||||     
227334 ttacttttcccaccatgctgcctcctcgcgtgccttgcaaaatttactaaaatactcctggtccggattacataatccggact--attgttagtgatttg 227431  T
173 ccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    | | ||||  ||||| |||||||||||| |||  |||| ||||| ||||||||||||||| ||||||||    
227432 cgaaaacag-aaatccggaccagatgttatgtaattttctgtgtttttctttgatgtcaagggtctctg 227499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 69 - 167
Target Start/End: Complemental strand, 47375157 - 47375059
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtg 167  Q
    |||||||||||||||||| || |||||||||||||| |||  |||| ||||| |||||| |||||||| |||||  |||||||| || |||||| ||||    
47375157 actattacttttcccaccctgatgccttctcgcgcgcccttcaaaaatttcataaatacacctggtccgaattacgtaatccggaccagattgtaagtg 47375059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 121 - 241
Target Start/End: Original strand, 41174571 - 41174689
Alignment:
121 aaaatacccctggtccaaattatataatccggtccggattgttagtgattttccataacattaaatctggaccagatgttttgtgcttttttgtgtcttt 220  Q
    ||||||||||||||||  |||| |||||||||  | ||||||| ||||||| ||| || | ||| ||  ||||||||||| |||  ||||||||||||||    
41174571 aaaatacccctggtccggattacataatccggatcagattgtttgtgattt-ccagaatagtaa-tccagaccagatgttatgtaattttttgtgtcttt 41174668  T
221 ctttgatgtcaatggtctctg 241  Q
    |||||||||||| ||||||||    
41174669 ctttgatgtcaagggtctctg 41174689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 69 - 171
Target Start/End: Complemental strand, 36403118 - 36403016
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    ||||||||||||| |||| |||||||| |||||||| |||  ||||||| | |||||||||||| | |  ||||||||||||||  |  |||||||||||    
36403118 actattacttttctcaccctgctgcctcctcgcgcgccctgcaaaatttactaaaatacccctgattcggattatataatccggatcaaattgttagtga 36403019  T
169 ttt 171  Q
    |||    
36403018 ttt 36403016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 69 - 167
Target Start/End: Complemental strand, 49440699 - 49440601
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtg 167  Q
    |||||||||||| ||||| || |||||||||||||| |||  |||| ||||| ||||||| |||||||  ||||  |||||||| || |||||||||||    
49440699 actattactttttccaccctgttgccttctcgcgcgccctgcaaaaatttcataaatacctctggtccggattacgtaatccggaccagattgttagtg 49440601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 184 - 241
Target Start/End: Original strand, 47646728 - 47646785
Alignment:
184 aatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||| |||||||||||| |||| |||| ||||||||||||||||||||| ||||||||    
47646728 aatccggaccagatgttatgtgattttctgtgtctttctttgatgtcaagggtctctg 47646785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 131
Target Start/End: Complemental strand, 8735794 - 8735734
Alignment:
71 tattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccct 131  Q
    |||||||||||||||| || || ||||||||||| ||| |||||||| ||||||| |||||    
8735794 tattacttttcccaccctgttgtcttctcgcgcgccctgtaaaatttccaaaaatgcccct 8735734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 131
Target Start/End: Complemental strand, 9088035 - 9087975
Alignment:
71 tattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccct 131  Q
    |||||||||||||||| || || ||||||||||| ||| |||||||| ||||||| |||||    
9088035 tattacttttcccaccctgttgtcttctcgcgcgccctgtaaaatttccaaaaatgcccct 9087975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 69 - 167
Target Start/End: Original strand, 16481094 - 16481191
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtg 167  Q
    |||||||||||||| ||| || || ||||||||||| | | ||||| || || |||||||||||||||| ||||  ||||| || || |||||||||||    
16481094 actattacttttcc-accctgttgtcttctcgcgcgccttgtaaaaattccataaatacccctggtccagattacgtaatctggaccagattgttagtg 16481191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 71 - 117
Target Start/End: Original strand, 18875737 - 18875783
Alignment:
71 tattacttttcccaccttgctgccttctcgcgcgtcctctaaaattt 117  Q
    |||||||||||||||| |||||||||||||| || |||| |||||||    
18875737 tattacttttcccaccctgctgccttctcgcacgccctccaaaattt 18875783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 69 - 167
Target Start/End: Complemental strand, 44208018 - 44207920
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtg 167  Q
    |||||||||||||||||| || |||||||||||||| |||  |||| || || ||||||| ||||| |  ||||| |||||  | || |||||||||||    
44208018 actattacttttcccaccctgttgccttctcgcgcgccctgcaaaaattccataaatacctctggttcggattatgtaatcttgaccagattgttagtg 44207920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 208 - 241
Target Start/End: Complemental strand, 3733820 - 3733787
Alignment:
208 tttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||||||||||||||||||||||||| ||||||||    
3733820 tttttgtgtctttctttgatgtcaagggtctctg 3733787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 208 - 241
Target Start/End: Complemental strand, 26982619 - 26982586
Alignment:
208 tttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||||||||||||||||||||||||| ||||||||    
26982619 tttttgtgtctttctttgatgtcaagggtctctg 26982586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Original strand, 9126872 - 9126904
Alignment:
209 ttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||||||||||||||||||||| ||||||||    
9126872 ttttgtgtctttctttgatgtcaagggtctctg 9126904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Original strand, 9134979 - 9135011
Alignment:
209 ttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||||||||||||||||||||| ||||||||    
9134979 ttttgtgtctttctttgatgtcaagggtctctg 9135011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Complemental strand, 21450454 - 21450422
Alignment:
209 ttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||||||||||||||||||||| ||||||||    
21450454 ttttgtgtctttctttgatgtcaagggtctctg 21450422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Complemental strand, 49327607 - 49327575
Alignment:
209 ttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||||||||||||||||||||| ||||||||    
49327607 ttttgtgtctttctttgatgtcaagggtctctg 49327575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Complemental strand, 49440561 - 49440529
Alignment:
209 ttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||||||||||||||||||||| ||||||||    
49440561 ttttgtgtctttctttgatgtcaagggtctctg 49440529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 208 - 240
Target Start/End: Original strand, 53393788 - 53393820
Alignment:
208 tttttgtgtctttctttgatgtcaatggtctct 240  Q
    ||||||||||||||||||||||||| |||||||    
53393788 tttttgtgtctttctttgatgtcaagggtctct 53393820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 42)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 69 - 241
Target Start/End: Original strand, 45924303 - 45924474
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||| ||||  ||||||||||||||||| | |  |||||||| |||||||||||||||||  |||||||||||||| ||  |||||||||||    
45924303 actattactttttccactctgctgccttctcgcgcgccatgcaaaatttttaaaaatacccctggtccggattatataatccggaccaaattgttagtga 45924402  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||||||  ||||||||||  |||||||||||| ||||| ||||||||||||||||||||||||||||||||||    
45924403 ttttccggaacattaaattcggaccagatgttatgtgc-tttttgtgtctttctttgatgtcaatggtctctg 45924474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 72 - 241
Target Start/End: Original strand, 16451638 - 16451806
Alignment:
72 attacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgattt 171  Q
    ||||||||||||||| |||||||||||||||||  ||  ||||||||||||||||||| |||||   |||||||||||||| || |||||||||||||||    
16451638 attacttttcccaccctgctgccttctcgcgcgctctgcaaaattttcaaaaatacccttggtctggattatataatccggaccagattgttagtgattt 16451737  T
172 tc-cataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||  | ||||  |||||  ||||||||||| ||||||||||||||||||||||||||||||| ||||||||    
16451738 tcggaaaaca--aaatccagaccagatgttatgtgcttttttgtgtctttctttgatgtcaagggtctctg 16451806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 73 - 238
Target Start/End: Complemental strand, 38551697 - 38551533
Alignment:
73 ttacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgatttt 172  Q
    |||||||||||||| ||||||||||||||||| |||  ||||||| ||||||||||||||||||  |||||||||||||| || ||||||||||||||||    
38551697 ttacttttcccaccctgctgccttctcgcgcgccctgcaaaatttccaaaaatacccctggtccggattatataatccggaccagattgttagtgatttt 38551598  T
173 ccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtct 238  Q
     |  || |  ||||  |||||||||||| |||||||||||||||||||| |||||||||| |||||    
38551597 -cggaaaacgaaatacggaccagatgttatgtgcttttttgtgtctttccttgatgtcaagggtct 38551533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 71 - 240
Target Start/End: Complemental strand, 15543272 - 15543103
Alignment:
71 tattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgatt 170  Q
    |||||||||||||||||||||||||||||||||| |||  ||||||| ||||||||||| ||||||| |||||||||||| | |  ||||||||||||||    
15543272 tattacttttcccaccttgctgccttctcgcgcgccctacaaaatttccaaaaatacccatggtccagattatataatccagactagattgttagtgatt 15543173  T
171 ttccataacattaaa-tctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctct 240  Q
    || |  || |||||| || | || ||||||| ||||||||||| ||||||||||||||||||| |||||||    
15543172 tt-cggaaaattaaattcggaacaagatgttatgtgcttttttttgtctttctttgatgtcaagggtctct 15543103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 69 - 241
Target Start/End: Complemental strand, 35320328 - 35320157
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||| |||||||| |||||||||||||| |||  ||||||| ||||||||||||||||||  |||||||||||||| || ||||||||||||    
35320328 actattacttttaccaccttggtgccttctcgcgcgccctgcaaaatttccaaaaatacccctggtccggattatataatccggaccagattgttagtga 35320229  T
169 -ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
     ||||  || | ||  |||| |||||||||||| ||||||||||||||||||||||| ||||||| ||| ||||    
35320228 tttttggattatat--aatccggaccagatgttatgtgcttttttgtgtctttcttttatgtcaagggtatctg 35320157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 69 - 241
Target Start/End: Complemental strand, 4190307 - 4190136
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||||||||| || || ||||| ||||| |||  ||||||| |||||||||||||||| |  |||||||||||| | || ||||||||| ||    
4190307 actattacttttcccaccctgttgtcttcttgcgcgcccttcaaaatttccaaaaatacccctggttcggattatataatcctgaccagattgttagcga 4190208  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
     |||||  || |||||||  |||||| ||||| ||||||||||||||||||||||||||||||  ||||||||    
4190207 -tttccggaaaattaaattcggaccaaatgttatgtgcttttttgtgtctttctttgatgtcatgggtctctg 4190136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 69 - 241
Target Start/End: Complemental strand, 28311324 - 28311153
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||||||||| |||||||||||||||||||||  |||||||  |||| |||||||||| |  || ||||||||||| || ||||||||||||    
28311324 actattacttttcccaccctgctgccttctcgcgcgtcctgcaaaatttcaaaaattacccctggttcggataatataatccggaccagattgttagtga 28311225  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||||    || ||| |||| |||||||||||| || | |||||||||||||||||| ||| ||| ||||||||    
28311224 tttt-tggaaaatttaatccggaccagatgttatgcgtttttttgtgtctttctttaatgccaagggtctctg 28311153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 69 - 241
Target Start/End: Original strand, 49374023 - 49374194
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||||||||| |||| |||||||||||| |||  ||||||||||||||||||||||||||| |||||| ||||||| |  |||||||| |||    
49374023 actattacttttcccaccctgctaccttctcgcgcgccctgcaaaattttcaaaaatacccctggtccagattatacaatccggacgagattgttaatga 49374122  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
     |  ||  || |  ||||| |||||| ||||| || ||||||||||||||||||||||||||||  |||||||    
49374123 -tccccgaaaaacaaaatccggaccatatgttatgcgcttttttgtgtctttctttgatgtcaagagtctctg 49374194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 69 - 239
Target Start/End: Original strand, 35158417 - 35158587
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||||||||| |||||||| |||||||| |||  ||||||| | ||||||||||||||||  |||| ||||||||| || |||||||||| |    
35158417 actattacttttcccaccctgctgcctcctcgcgcgccctgcaaaatttactaaaatacccctggtccggattacataatccggaccagattgttagtta 35158516  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctc 239  Q
    ||| |   ||||  ||||  |||||||||||| |||  |||| ||||||||||||||||||||| ||||||    
35158517 tttccggaaacagaaaattcggaccagatgttatgtaattttctgtgtctttctttgatgtcaagggtctc 35158587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 69 - 239
Target Start/End: Original strand, 45228789 - 45228958
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||| ||||| ||||| ||||||||||| |||  ||||||| | ||||||||| || ||   |||| ||||||||| || ||||||||||||    
45228789 actattactttttccaccctgctgtcttctcgcgcgccctgcaaaatttactaaaatacccttgatcatgattacataatccggaccagattgttagtga 45228888  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctc 239  Q
    |||||   ||||  ||||| |||||||||||| |||  |||| ||||||||||||||||||||| ||||||    
45228889 ttttcggaaaca-aaaatccggaccagatgttatgtaattttctgtgtctttctttgatgtcaagggtctc 45228958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 69 - 241
Target Start/End: Complemental strand, 52417371 - 52417201
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||||| ||| ||||||||||||||| | |||  ||||||| | ||||||||||||||||  ||||  |||||||| || |||||||||||     
52417371 actattacttttcctaccctgctgccttctcgcgtgccctgcaaaatttactaaaatacccctggtccggattacgtaatccggaccagattgttagtg- 52417273  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
     |||||  ||    ||||| |||||| ||||| |||  |||||| ||||||||||||||||||| ||||||||    
52417272 -tttccggaaacagaaatccggaccatatgttatgtaattttttatgtctttctttgatgtcaagggtctctg 52417201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 69 - 233
Target Start/End: Complemental strand, 2016224 - 2016062
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    ||||| |||||||||||| ||||||||||| ||||| |||  | ||||| ||||||||||| ||||    |||||||||||||| |  ||||||||||||    
2016224 actatcacttttcccaccctgctgccttcttgcgcg-cctacataatttacaaaaatacccatggtatggattatataatccggactagattgttagtga 2016126  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaat 233  Q
    | | ||  || |  ||||| |||||||||||| |||| |||||||||||||||||||||||||||    
2016125 tat-ccggaaaacgaaatccggaccagatgttatgtgattttttgtgtctttctttgatgtcaat 2016062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 69 - 241
Target Start/End: Complemental strand, 45029459 - 45029288
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||| ||||| |||||||||||| |||  |||  ||||||| | ||||||||||| ||||  |||| ||||| |||  | ||||||||||||    
45029459 actattactttttccaccctgctgccttctcccgcaccctgcaaaatttactaaaatacccctagtccggattacataattcggatcagattgttagtga 45029360  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||| | | ||||  ||||  |||||||||||| |||  |||| ||||||||||||||||||||| ||||||||    
45029359 tttccgaaaaca-gaaattcggaccagatgttatgtaattttctgtgtctttctttgatgtcaagggtctctg 45029288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 69 - 229
Target Start/End: Complemental strand, 9036537 - 9036379
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||| |||||   |||||| |||||||| |||  ||||||| | ||||||||||||||||  |||| |||||||||  | ||||||| ||||    
9036537 actattactttttccacccgactgcctcctcgcgcgccctgcaaaatttactaaaatacccctggtccggattacataatccggatcagattgttcgtga 9036438  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgt 229  Q
    ||| ||  ||||  |||||||||||||||||| |||  |||| ||||||||||||||||||    
9036437 ttt-ccggaacag-aaatctggaccagatgttatgtaattttctgtgtctttctttgatgt 9036379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 69 - 241
Target Start/End: Complemental strand, 28781209 - 28781038
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    ||||||||||||| |||| |||||||| |||| ||  |||  ||||||| | ||||||||||||||||  ||||   ||||||| || ||||||||||||    
28781209 actattacttttctcaccatgctgcctcctcgtgcaccctgcaaaatttactaaaatacccctggtccggattacgcaatccggaccagattgttagtga 28781110  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||     ||||  ||||| |||||||||||| |||  |||| ||||||||||||||||||||| ||||||||    
28781109 tttctggaaacag-aaatccggaccagatgttatgtaattttctgtgtctttctttgatgtcaagggtctctg 28781038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 69 - 241
Target Start/End: Original strand, 40727724 - 40727895
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||| |||||||| |||| |||||||| |||||    |||  ||||||| | ||||||||||||||||  |||||| |||| || || ||||||||||||    
40727724 actactacttttctcaccctgctgcctcctcgcataccctgcaaaatttactaaaatacccctggtccggattatacaatctggaccagattgttagtga 40727823  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||   ||||  |||||  ||||||||||| |||  |||| ||||||||||||||||||||||| ||||||    
40727824 ttttcggaaaca-gaaatccagaccagatgttatgttattttctgtgtctttctttgatgtcaatgatctctg 40727895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 71 - 241
Target Start/End: Original strand, 51538346 - 51538515
Alignment:
71 tattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgatt 170  Q
    ||||| |||||||||| ||||||||||||||  | |||  ||||||| | | |||| |||||||||  |||| ||||| ||| |  ||||||||||||||    
51538346 tattatttttcccaccctgctgccttctcgcatgccctgcaaaatttacgacaataaccctggtccggattacataattcggactagattgttagtgatt 51538445  T
171 ttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    | |   ||||  ||||| |||||||||||| |||  |||| ||||||||||||||||||||| ||||||||    
51538446 tccggaaacag-aaatccggaccagatgttatgtaattttctgtgtctttctttgatgtcaagggtctctg 51538515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 145 - 241
Target Start/End: Original strand, 6963235 - 6963330
Alignment:
145 taatccggtccggattgttagtgattttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||||| || |||||||||||||||||   || ||| |||| |||||||||||| ||||||||| ||||||||||||| ||||||| ||||||||    
6963235 taatccggaccagattgttagtgattttcaggaa-attgaatccggaccagatgttatgtgcttttctgtgtctttctttaatgtcaagggtctctg 6963330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 78 - 172
Target Start/End: Complemental strand, 168973 - 168879
Alignment:
78 tttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgatttt 172  Q
    ||||||||| | ||||||||||||| | |||  |||||||||||| ||||||||||| |  |||||||||| ||| || ||||||||||||||||    
168973 tttcccaccctactgccttctcgcgtgccctacaaaattttcaaatatacccctggttcggattatataattcggaccagattgttagtgatttt 168879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 111 - 241
Target Start/End: Complemental strand, 43842274 - 43842145
Alignment:
111 aaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgattttccataacattaaatctggaccagatgttttgtgctttt 210  Q
    ||||||| | ||||||||| ||||| | |||| |||||||||  | |||||||||||||||||   ||||  ||||| || ||||||||| |||  ||||    
43842274 aaaatttactaaaatacccttggtctagattacataatccggatcagattgttagtgattttcggaaacag-aaatccggcccagatgttatgtaatttt 43842176  T
211 ttgtgtctttctttgatgtcaatggtctctg 241  Q
     ||||||||||||||||||||| ||||||||    
43842175 ctgtgtctttctttgatgtcaagggtctctg 43842145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 69 - 205
Target Start/End: Original strand, 45458040 - 45458175
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||||||||| |||||||| |||||| | | |  ||||||| | ||||||||| ||||||  |||| ||||||||  || |||| ||||| |    
45458040 actattacttttcccaccctgctgcctcctcgcgtgccttgcaaaatttactaaaatacccttggtccggattacataatccgaaccagattattagtta 45458139  T
169 ttttccataacattaaatctggaccagatgttttgtg 205  Q
    ||||| | |||| |||||||||| |||||||| ||||    
45458140 ttttcgaaaaca-taaatctggatcagatgttatgtg 45458175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 183 - 241
Target Start/End: Original strand, 4047951 - 4048008
Alignment:
183 aaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||| ||||||||||| |||| |||||||||||||||||||||||||| ||||||||    
4047951 aaatctagaccagatgttatgtg-ttttttgtgtctttctttgatgtcaagggtctctg 4048008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 183 - 241
Target Start/End: Complemental strand, 38218593 - 38218535
Alignment:
183 aaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||||| |||||||||||| |||  |||||||||||||||||||||||||| ||||||||    
38218593 aaatccggaccagatgttatgtaattttttgtgtctttctttgatgtcaagggtctctg 38218535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 73 - 131
Target Start/End: Original strand, 42660144 - 42660202
Alignment:
73 ttacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccct 131  Q
    |||||||||||||| |  |||||||||||||| ||| ||||||||||||||||||||||    
42660144 ttacttttcccaccctattgccttctcgcgcgccctgtaaaattttcaaaaatacccct 42660202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 83 - 212
Target Start/End: Complemental strand, 27283779 - 27283651
Alignment:
83 caccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgattttccataacatt 182  Q
    ||||||||||||||||||   | |||  ||||||||| |||||||||||||| |  |||||||||||||  |  |||||||| ||| |||||  || |||    
27283779 caccttgctgccttctcgtatgccctgcaaaattttctaaaatacccctggttcggattatataatccgaactagattgttaatga-tttccgaaaaatt 27283681  T
183 aaatctggaccagatgttttgtgctttttt 212  Q
    ||||| |||||||||||| |||| ||||||    
27283680 aaatccggaccagatgttatgtgttttttt 27283651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 69 - 241
Target Start/End: Original strand, 16023572 - 16023743
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||| ||| | | |||| |||||||||  |||  ||||||| | |||||||||||||| |  |||| ||||| ||| |   |||||||||||    
16023572 actattactttttccatcctactgcgttctcgcgcaccctgcaaaatttactaaaatacccctggttcggattacataattcggacaatattgttagtga 16023671  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||| |  |||||  | ||| ||||||||| || |||  |||| ||||||||||||||||||||| ||||||||    
16023672 tttccggtaacaa-atatccggaccagatcttatgtaattttctgtgtctttctttgatgtcaagggtctctg 16023743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 121 - 241
Target Start/End: Original strand, 30003362 - 30003481
Alignment:
121 aaaatacccctggtccaaattatataatccggtccggattgttagtgattttccataacattaaatctggaccagatgttttgtgcttttttgtgtcttt 220  Q
    |||||| | |||||||  |||||||||||||| || |||||||||| ||||     ||||  ||||| |||||||||||| |||  |||| |||||||||    
30003362 aaaatatctctggtccggattatataatccggaccagattgttagttatttctggaaacag-aaatccggaccagatgttatgtaattttctgtgtcttt 30003460  T
221 ctttgatgtcaatggtctctg 241  Q
    |||||||||||| ||||||||    
30003461 ctttgatgtcaagggtctctg 30003481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 241
Target Start/End: Complemental strand, 56463992 - 56463909
Alignment:
157 gattgttagtgattttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||||||||||||||   ||||  ||||| |||||||||||| |||  |||| ||||||||||||||||||||| ||||||||    
56463992 gattgttagtgattttcggaaacag-aaatccggaccagatgttatgtaattttctgtgtctttctttgatgtcaagggtctctg 56463909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 82 - 241
Target Start/End: Original strand, 31092818 - 31092976
Alignment:
82 ccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgattttccataacat 181  Q
    ||||| |||||||||||||||||  || |||||||| | |||||||||||| |||  |||| ||| ||||| ||  ||||||||| ||||     ||||     
31092818 ccaccatgctgccttctcgcgcgctctataaaatttactaaaatacccctgctccggattacatattccggaccaaattgttagttatttctggaaaca- 31092916  T
182 taaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
     |||||||||||||||||| |||  || |  |||||||||||||||||||| | ||||||    
31092917 gaaatctggaccagatgttatgtaattctccgtgtctttctttgatgtcaaggatctctg 31092976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 69 - 167
Target Start/End: Complemental strand, 40693412 - 40693314
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtg 167  Q
    ||||||| ||||||||||||| |||||||||| ||| | | ||||| || || ||||||| |||||||  ||||  |||||||| || |||||||||||    
40693412 actattatttttcccaccttgttgccttctcgtgcgccttgtaaaaattccataaatacctctggtccggattacgtaatccggaccagattgttagtg 40693314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 145 - 230
Target Start/End: Original strand, 33280862 - 33280946
Alignment:
145 taatccggtccggattgttagtgattttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtc 230  Q
    |||||||| || ||||||||||||||| | | ||||  |||||||||||| ||||| |||| |||| || ||||||||||||||||    
33280862 taatccggaccagattgttagtgatttccgaaaacag-aaatctggaccaaatgttatgtgtttttctgcgtctttctttgatgtc 33280946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 73 - 136
Target Start/End: Original strand, 17646902 - 17646965
Alignment:
73 ttacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtcc 136  Q
    ||||||| |||||| |||||||||||| |||| |||  |||| |||||| ||||||||||||||    
17646902 ttactttacccaccatgctgccttctcacgcgccctgcaaaaatttcaataatacccctggtcc 17646965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 71 - 125
Target Start/End: Original strand, 54630936 - 54630990
Alignment:
71 tattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaat 125  Q
    |||||||||||||||| |   |||||||| |||||||| ||||||||||||||||    
54630936 tattacttttcccaccctatggccttctctcgcgtcctgtaaaattttcaaaaat 54630990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 69 - 167
Target Start/End: Complemental strand, 55614279 - 55614182
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtg 167  Q
    |||||||||||||| ||| || || ||||||||||| | | ||||| || || |||||||||||||||| ||||  ||||| || || |||||||||||    
55614279 actattacttttcc-accctgttgtcttctcgcgcgccttgtaaaaattccataaatacccctggtccagattacgtaatctggaccagattgttagtg 55614182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 69 - 126
Target Start/End: Original strand, 33280802 - 33280859
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaata 126  Q
    |||||||||||||||||| | |||||||||||||||| ||  ||||||| | ||||||    
33280802 actattacttttcccaccctactgccttctcgcgcgttctgcaaaatttactaaaata 33280859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 211 - 240
Target Start/End: Original strand, 53269245 - 53269274
Alignment:
211 ttgtgtctttctttgatgtcaatggtctct 240  Q
    ||||||||||||||||||||||||||||||    
53269245 ttgtgtctttctttgatgtcaatggtctct 53269274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 69 - 238
Target Start/End: Original strand, 55136365 - 55136533
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||| ||||| |||||||| ||  |||  |||  ||||||| | |||||||||||| | |  |||| |||||||||  | ||||||||||||    
55136365 actattactttttccaccctgctgcctcctttcgcaccctgcaaaatttactaaaatacccctgattcggattacataatccggatcagattgttagtga 55136464  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtct 238  Q
    |||||   ||||  ||||| |||| | ||||| |||  |||  |||||||| |||||||||||| |||||    
55136465 ttttcggaaaca-gaaatccggacaaaatgttatgtaatttgatgtgtcttcctttgatgtcaagggtct 55136533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Original strand, 13721187 - 13721219
Alignment:
209 ttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||||||||||||||||||||| ||||||||    
13721187 ttttgtgtctttctttgatgtcaagggtctctg 13721219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Complemental strand, 16684538 - 16684506
Alignment:
209 ttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||||||||||||||||||||| ||||||||    
16684538 ttttgtgtctttctttgatgtcaagggtctctg 16684506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Complemental strand, 38990944 - 38990912
Alignment:
209 ttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||||||||||||||||||||| ||||||||    
38990944 ttttgtgtctttctttgatgtcaagggtctctg 38990912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Complemental strand, 45659806 - 45659774
Alignment:
209 ttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||||||||||||||||||||| ||||||||    
45659806 ttttgtgtctttctttgatgtcaagggtctctg 45659774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Original strand, 51888950 - 51888982
Alignment:
209 ttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||| ||||||||||||||||||||||||||||    
51888950 ttttttgtctttctttgatgtcaatggtctctg 51888982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 90; Significance: 1e-43; HSPs: 21)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 69 - 241
Target Start/End: Original strand, 29544105 - 29544274
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||||||||| ||||||||||||| ||| |||  ||||||| |||||||||||||||||| ||||||||||||||| || |||||||||||     
29544105 actattacttttcccaccctgctgccttctcgtgcgccctgcaaaatttccaaaaatacccctggtccgaattatataatccggaccagattgttagtg- 29544203  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
     |||||  || | |||||| |||||||||||| ||||||||||||||| ||||||||||||||| ||||||||    
29544204 -tttccggaa-actaaatccggaccagatgttatgtgcttttttgtgtgtttctttgatgtcaagggtctctg 29544274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 69 - 241
Target Start/End: Complemental strand, 43098977 - 43098807
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||||||||| ||||||||||||||||  |||  ||||||| |||||||||||| ||| |  |||||||||||| | || ||||||||||||    
43098977 actattacttttcccaccctgctgccttctcgcgcacccttcaaaatttccaaaaatacccccggttcggattatataatccagaccagattgttagtga 43098878  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||  |  || ||||||||||||||||||||| |||||||||||||||||||||||||||||||  |||||||    
43098877 ttt--ccgaaaattaaatctggaccagatgttatgtgcttttttgtgtctttctttgatgtcaacagtctctg 43098807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 69 - 241
Target Start/End: Original strand, 20091266 - 20091437
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    ||||||||||||| |||| ||||||||||||||||| |||  ||||||| |||||||||||||||||   ||||  |||||||| || ||||||||||||    
20091266 actattacttttcacaccctgctgccttctcgcgcgccctgcaaaatttccaaaaatacccctggtctggattacgtaatccggaccagattgttagtga 20091365  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
     |||||  || |||||||| |||||||||||| || | |||||||||||||||||||||||||||||||||||    
20091366 -tttccggaaaattaaatccggaccagatgttatgggtttttttgtgtctttctttgatgtcaatggtctctg 20091437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 101 - 241
Target Start/End: Complemental strand, 23144508 - 23144370
Alignment:
101 cgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgattttccataacattaaatctggaccagatgtt 200  Q
    ||||||||| |||||||||||| |||||| ||||||  |||||||||||||| || ||||||||||| ||||| | || |  ||||| ||| ||||||||    
23144508 cgcgtcctccaaaattttcaaatatacccttggtccggattatataatccggaccagattgttagtg-ttttcgaaaa-acgaaatccggatcagatgtt 23144411  T
201 ttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
     ||||||||||||||||||||||||||||||| ||||||||    
23144410 atgtgcttttttgtgtctttctttgatgtcaagggtctctg 23144370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 95 - 241
Target Start/End: Complemental strand, 13546596 - 13546451
Alignment:
95 ttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgattttccataacattaaatctggacca 194  Q
    |||||||||| |||  ||||||| |||||||||||||||| |  |||||||||| | | || ||||||||||||||| ||  || |||||||| ||||||    
13546596 ttctcgcgcgccctgcaaaatttccaaaaatacccctggttcggattatataatacagaccagattgttagtgattt-ccggaaaattaaatccggacca 13546498  T
195 gatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||| |||| ||||||||||||||||||||||||||  |||||||    
13546497 gatgttatgtggttttttgtgtctttctttgatgtcaagagtctctg 13546451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 95 - 241
Target Start/End: Original strand, 13677877 - 13678022
Alignment:
95 ttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgattttccataacattaaatctggacca 194  Q
    |||||||||| |||  ||||||| |||||||||||||||| |  |||||||||| | | || ||||||||||||||| ||  || |||||||| ||||||    
13677877 ttctcgcgcgccctgcaaaatttccaaaaatacccctggttcggattatataatacagaccagattgttagtgattt-ccggaaaattaaatccggacca 13677975  T
195 gatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||| |||| ||||||||||||||||||||||||||  |||||||    
13677976 gatgttatgtggttttttgtgtctttctttgatgtcaagagtctctg 13678022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 69 - 241
Target Start/End: Complemental strand, 8240426 - 8240255
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||| ||||| |||||||| |||||||| |||  ||||||| | ||||||   |||||||  |||| ||||||||| ||||||||||||| |    
8240426 actattactttttccaccctgctgcctcctcgcgcgccctacaaaatttactaaaatatttctggtccggattacataatccggaccggattgttagtta 8240327  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||| |   ||||  ||||| |||||||||||| |||  |||||||||||||||||| ||||||| ||||||||    
8240326 tttcctgaaaca-gaaatccggaccagatgttatgtaattttttgtgtctttctttaatgtcaagggtctctg 8240255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 69 - 241
Target Start/End: Original strand, 6347000 - 6347171
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||| | ||| ||||||||||||||||| |||  ||||||| | ||||||||||||||||  |||| |||||||||  |  |||||||||||    
6347000 actattactttttctaccctgctgccttctcgcgcgccctgcaaaatttactaaaatacccctggtccggattacataatccggagcaaattgttagtga 6347099  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
     | |||  || |  ||||  |||||||||||| || | |||||||||||||||||||||||||| ||| ||||    
6347100 -tatccgaaaaacgaaattcggaccagatgttatgcgtttttttgtgtctttctttgatgtcaagggtttctg 6347171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 69 - 232
Target Start/End: Complemental strand, 40105687 - 40105525
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||| ||||| |||||||| |||||||| |||  |||||||   ||||||||||||||||  |||| ||||| ||| || |||||||||| |    
40105687 actattactttttccaccctgctgcctcctcgcgcgccctgcaaaatttattaaaatacccctggtccggattacataattcggaccagattgttagtta 40105588  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaa 232  Q
    ||| |   ||||  ||||| |||||||||||| |||  |||| |||||||||||||||||||||    
40105587 tttccgcaaaca-gaaatccggaccagatgttatgtaattttctgtgtctttctttgatgtcaa 40105525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 73 - 241
Target Start/End: Original strand, 32337516 - 32337683
Alignment:
73 ttacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgatttt 172  Q
    |||||||||||||| |||||| |||||| | | |||  ||||||| ||||||||||| |||| |  ||||||||||| ||  | ||||||||| ||| |     
32337516 ttacttttcccaccctgctgctttctcgtgtgccctgcaaaatttccaaaaatacccttggttcggattatataatctggagcagattgttagcgatat- 32337614  T
173 ccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||  |  |  ||||| |||||||||||| |||||||||||||||||||||||||||||||  |||||||    
32337615 ccggacaaagaaatccggaccagatgttatgtgcttttttgtgtctttctttgatgtcaagagtctctg 32337683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 71 - 171
Target Start/End: Original strand, 37098099 - 37098199
Alignment:
71 tattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgatt 170  Q
    |||||||||||||||| || |||||||||||||| |||  ||||||| ||||||||||| |||||   |||||||||||||| || ||||||| ||||||    
37098099 tattacttttcccaccctgttgccttctcgcgcgccctgcaaaatttccaaaaatacccatggtctggattatataatccggaccagattgtttgtgatt 37098198  T
171 t 171  Q
    |    
37098199 t 37098199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 69 - 241
Target Start/End: Complemental strand, 39319034 - 39318863
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||||||||  || |||||||||||| |  ||  |||||||   ||||||||||||||||  |||| |||||| |  || |||||||||| |    
39319034 actattacttttcccactctgatgccttctcgcgtgctctgcaaaatttattaaaatacccctggtccggattacataatctgaaccagattgttagtta 39318935  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||||| | ||||  ||||| |||||||||||| |||  |||| |||||||||||||||| ||||  |||||||    
39318934 ttttcgaaaacag-aaatccggaccagatgttatgtaattttctgtgtctttctttgatatcaagagtctctg 39318863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 73 - 238
Target Start/End: Complemental strand, 586841 - 586676
Alignment:
73 ttacttttccc-accttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgattt 171  Q
    ||||||||||| ||| |||||  ||||||| || |||  ||||||| ||||||||||  |||||  ||||||||||||||   | ||||||||||||| |    
586841 ttacttttccccaccctgctgtattctcgcacgccctgcaaaatttccaaaaatacctgtggtctgaattatataatccgaagcagattgttagtgatat 586742  T
172 tccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtct 238  Q
     | | |  |  ||||| |||||||||||| |||| |||||||||||||||||||||||||| |||||    
586741 -ctagacaaagaaatccggaccagatgttatgtgtttttttgtgtctttctttgatgtcaagggtct 586676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 69 - 167
Target Start/End: Complemental strand, 12158 - 12060
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtg 167  Q
    |||||||||||||||||| || |||||||||||||| |||  |||| || || ||||||||||||||   ||||  |||||||| || |||||||||||    
12158 actattacttttcccaccctgttgccttctcgcgcgccctgcaaaaattccataaatacccctggtctggattacgtaatccggaccagattgttagtg 12060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 73 - 243
Target Start/End: Original strand, 627081 - 627252
Alignment:
73 ttacttttccc-accttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgattt 171  Q
    ||||||||||| ||| |||||| |||||||| | |||  ||||||| |||||||||   |||||  ||||||||||||||   | ||||||||||||| |    
627081 ttacttttccccaccctgctgcattctcgcgtgccctgcaaaatttccaaaaatacttgtggtctgaattatataatccgaagcagattgttagtgatat 627180  T
172 tccataacattaaatctggaccagatgttttgtgctttt-ttgtgtctttctttgatgtcaatggtctctgct 243  Q
     | | |  |  ||||| |||||||||||| |||| |||| |||||||||||||||||||||| ||||| ||||    
627181 -ctagacaaagaaatccggaccagatgttatgtgttttttttgtgtctttctttgatgtcaagggtctttgct 627252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 72 - 142
Target Start/End: Complemental strand, 42132301 - 42132231
Alignment:
72 attacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaatta 142  Q
    ||||||||| ||||| ||||||||||||| |||||||  |||| ||||| ||||||||||| ||| |||||    
42132301 attactttttccaccctgctgccttctcgtgcgtcctgcaaaaatttcataaatacccctgatccgaatta 42132231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 69 - 125
Target Start/End: Complemental strand, 9074246 - 9074190
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaat 125  Q
    |||||||||||||||||| |   |||||||| |||||||| ||||||||||||||||    
9074246 actattacttttcccaccatatggccttctcccgcgtcctgtaaaattttcaaaaat 9074190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 123
Target Start/End: Complemental strand, 24628173 - 24628121
Alignment:
71 tattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaa 123  Q
    |||||||||||||||| || ||| |||||||||| ||| ||||||||||||||    
24628173 tattacttttcccaccatgttgcattctcgcgcgccctataaaattttcaaaa 24628121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 102 - 241
Target Start/End: Complemental strand, 35684420 - 35684283
Alignment:
102 gcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgattttccataacattaaatctggaccagatgttt 201  Q
    |||||||  ||||||| | |||||| ||||||||   |||| |||||||||  | ||||||||||| |||||   ||||| ||||||||| || |||||     
35684420 gcgtcctgcaaaatttactaaaatatccctggtctggattacataatccggatcagattgttagtg-ttttcggaaacat-aaatctggaacaaatgtta 35684323  T
202 tgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||  |||||||||| |||||||||||| || ||||||||    
35684322 tgtaattttttgtgtttttctttgatgttaagggtctctg 35684283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 241
Target Start/End: Complemental strand, 39260618 - 39260560
Alignment:
183 aaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||||| |||||||||||| |||  |||| ||||| ||||||||||||||| ||||||||    
39260618 aaatccggaccagatgttatgtaattttctgtgtttttctttgatgtcaagggtctctg 39260560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 125
Target Start/End: Complemental strand, 40995375 - 40995319
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaat 125  Q
    |||||||||||||||| | |   |||||||| |||||||| ||||||||||||||||    
40995375 actattacttttcccatcctatggccttctcccgcgtcctgtaaaattttcaaaaat 40995319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 69; Significance: 4e-31; HSPs: 17)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 69 - 241
Target Start/End: Original strand, 43457886 - 43458057
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    ||||||||||||| ||||||||||||||||| |||| |||  ||||||||||||||||| ||||||||  |||||||| ||||  || ||||||||||||    
43457886 actattacttttcacaccttgctgccttctcacgcgccctgcaaaattttcaaaaatactcctggtccggattatatattccgaaccagattgttagtga 43457985  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||| |  || |  ||||  |||||| || || ||||||||||||||||||||||| ||||||| ||||||||    
43457986 tttt-cggaatacgaaattcggaccaaatattatgtgcttttttgtgtctttctttcatgtcaagggtctctg 43458057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 69 - 238
Target Start/End: Original strand, 46254565 - 46254733
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||||||||| |||||||| |||||||| |||  ||||||| | ||||||||||||||||  |||| |||||||||  | ||||||||||||    
46254565 actattacttttcccaccctgctgcctcctcgcgcgccctgcaaaatttactaaaatacccctggtccggattacataatccggatcagattgttagtga 46254664  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtct 238  Q
    ||| |   ||||  |||||||||||||||||| |||  ||||  |||||||||||||||||||| |||||    
46254665 tttccggaaaca-gaaatctggaccagatgttatgtaattttccgtgtctttctttgatgtcaagggtct 46254733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 71 - 241
Target Start/End: Complemental strand, 14817082 - 14816914
Alignment:
71 tattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgatt 170  Q
    ||||||||||  |||| | |||||||||||||||||||  ||||||| |||||||||||| | ||   |||||||||||||| || |||| |||||||||    
14817082 tattacttttttcaccctactgccttctcgcgcgtcctgcaaaatttccaaaaatacccccgatctggattatataatccggaccagattattagtgatt 14816983  T
171 ttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||    || |||||||  |||| ||||||| ||||||||||| ||||||||||||||||||| ||||||||    
14816982 tt--ggaaaattaaattcggacaagatgttatgtgcttttttttgtctttctttgatgtcaaaggtctctg 14816914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 71 - 241
Target Start/End: Complemental strand, 15264078 - 15263910
Alignment:
71 tattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgatt 170  Q
    ||||||||||  |||| | |||||||||||||||||||  ||||||| |||||||||||| | ||   |||||||||||||| || |||| |||||||||    
15264078 tattacttttttcaccctactgccttctcgcgcgtcctgcaaaatttccaaaaatacccccgatctggattatataatccggaccagattattagtgatt 15263979  T
171 ttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||    || |||||||  |||| ||||||| ||||||||||| ||||||||||||||||||| ||||||||    
15263978 tt--ggaaaattaaattcggacaagatgttatgtgcttttttttgtctttctttgatgtcaaaggtctctg 15263910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 69 - 241
Target Start/End: Complemental strand, 34848313 - 34848142
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    ||||||| |||||||||| |||||||||||||||| ||||  |||||||   |||||| |||||||||  |||| || || |||  | ||||||||||||    
34848313 actattatttttcccaccctgctgccttctcgcgcatcctacaaaatttattaaaatatccctggtccggattacattattcggatcagattgttagtga 34848214  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||| |   ||||  ||||| ||||||||  || |||  |||| | ||||||||||||||||||||||||||||    
34848213 tttccggaaaca-gaaatccggaccagaatttatgtaattttctatgtctttctttgatgtcaatggtctctg 34848142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 78 - 240
Target Start/End: Complemental strand, 25529533 - 25529372
Alignment:
78 tttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgattttccata 177  Q
    ||||| |||| | |||||||||||||| | | || || ||||| |||||| | | |||   ||||||||  |||| || ||||||||||||||| ||  |    
25529533 tttcctacctcgttgccttctcgcgcgccttgtagaagtttcataaatactctttgtctggattatatatcccggaccagattgttagtgattt-ccgga 25529435  T
178 acattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctct 240  Q
    | |  ||||| ||||||||| || ||||||||||||||||||||||||||||||| |||||||    
25529434 atacgaaatccggaccagatattatgtgcttttttgtgtctttctttgatgtcaagggtctct 25529372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 183 - 241
Target Start/End: Original strand, 43270074 - 43270132
Alignment:
183 aaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||||| |||||||||||| |||  |||||||||||||||||||||||||||||||||||    
43270074 aaatccggaccagatgttatgtaattttttgtgtctttctttgatgtcaatggtctctg 43270132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 73 - 241
Target Start/End: Original strand, 35794180 - 35794347
Alignment:
73 ttacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgatttt 172  Q
    |||||||||||||| | |||||||||||| || |||  ||||||| | |||||| ||||||| |  |||| ||||||||  || |||||||||||||||     
35794180 ttacttttcccaccctactgccttctcgcacgacctgcaaaatttactaaaataaccctggttcggattacataatccgaaccagattgttagtgatttc 35794279  T
173 ccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
        ||||  ||||| |||| ||||||| |||  |||| | ||||||||||||||||||| ||||||||    
35794280 tggaaaca-aaaatccggactagatgttatgtaattttctctgtctttctttgatgtcaagggtctctg 35794347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 69 - 241
Target Start/End: Complemental strand, 36312518 - 36312349
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||||||||| |||||||| |||||||   ||  ||||||| | |||||||| ||||| |  ||||  |||||||| || |||||||||||     
36312518 actattacttttcccaccctgctgcctcctcgcgcactctacaaaatttactaaaatacctctggttcggattacgtaatccggaccagattgttagtg- 36312420  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||| | | ||||  ||||| ||| |||||||| |||  |||| | ||||||||||||||||||| ||||||||    
36312419 tttccgaaaaca-gaaatccgga-cagatgttatgtaattttctatgtctttctttgatgtcaaaggtctctg 36312349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 69 - 134
Target Start/End: Original strand, 26791699 - 26791764
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggt 134  Q
    ||||||| |||||||||| || ||||||||||||||||||  |||| || || |||||||||||||    
26791699 actattatttttcccaccctgttgccttctcgcgcgtcctgcaaaaattccataaatacccctggt 26791764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 69 - 125
Target Start/End: Complemental strand, 29332685 - 29332629
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaat 125  Q
    ||||||||||||||||||||| |||||||||||||| |||  |||| ||||| ||||    
29332685 actattacttttcccaccttgttgccttctcgcgcgccctgcaaaaatttcataaat 29332629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 69 - 167
Target Start/End: Complemental strand, 7255831 - 7255733
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtg 167  Q
    ||||||||||||||||| ||| ||||||||||||||  ||  |||| || || ||||||||||||| |  ||||  |||||||| ||  ||||||||||    
7255831 actattacttttcccactttgttgccttctcgcgcgctctgcaaaaattccataaatacccctggttcggattacgtaatccggaccaaattgttagtg 7255733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 69 - 167
Target Start/End: Complemental strand, 15032973 - 15032875
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtg 167  Q
    |||||||| |||  |||| || |||||||||| ||| |||  |||| ||||| |||||||||||||||  ||||  |||||||| || |||||||||||    
15032973 actattacctttttcaccctgttgccttctcgtgcgccctgcaaaaatttcataaatacccctggtccggattacgtaatccggaccagattgttagtg 15032875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 69 - 166
Target Start/End: Original strand, 108407 - 108504
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagt 166  Q
    ||||||||||||||||||||  | || ||||||||| ||| ||||| ||||| |||||||  | ||||| ||||  |||||||  || ||||||||||    
108407 actattacttttcccaccttatttccctctcgcgcgccctgtaaaaatttcataaatacctttagtccagattacgtaatccgaaccagattgttagt 108504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Complemental strand, 15032835 - 15032803
Alignment:
209 ttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||||||||||||||||||||| ||||||||    
15032835 ttttgtgtctttctttgatgtcaagggtctctg 15032803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Original strand, 37998511 - 37998543
Alignment:
209 ttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||||||||||||||||||||| ||||||||    
37998511 ttttgtgtctttctttgatgtcaaaggtctctg 37998543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 125
Target Start/End: Original strand, 42864545 - 42864601
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaat 125  Q
    ||||||||||||| ||||||   |||||||| || | ||||||||||||||||||||    
42864545 actattacttttctcaccttaaggccttctcccgtgccctctaaaattttcaaaaat 42864601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 69; Significance: 4e-31; HSPs: 12)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 69 - 241
Target Start/End: Complemental strand, 9305396 - 9305225
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    ||||||| |||| ||||| |||| ||||||||| || ||| |||||||| |||||||||||||||| |  ||||||||||| || || ||||||||||||    
9305396 actattattttttccaccatgctaccttctcgcacgccctgtaaaatttccaaaaatacccctggttcggattatataatctggaccagattgttagtga 9305297  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
     |  ||  || |||||||  ||| |||||||| ||||||||||||||||||||||||||||||| ||||||||    
9305296 -taaccggaaaattaaatacggatcagatgttatgtgcttttttgtgtctttctttgatgtcaagggtctctg 9305225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 71 - 232
Target Start/End: Original strand, 31271051 - 31271210
Alignment:
71 tattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgatt 170  Q
    ||||||||||||||||| |||||||||||||||| |||  ||||||| | |||||| ||||||| |  |||| ||||||||| || ||||||||||||||    
31271051 tattacttttcccacct-gctgccttctcgcgcgccctgcaaaatttactaaaataaccctggttcggattacataatccggaccagattgttagtgatt 31271149  T
171 ttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaa 232  Q
    | | | ||||  ||||| |||||||||||| |||| |||| |||||||||||||||||||||    
31271150 tccgaaaaca-gaaatccggaccagatgttatgtgtttttctgtgtctttctttgatgtcaa 31271210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 69 - 232
Target Start/End: Original strand, 31318228 - 31318390
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||| ||||||||||| ||||||||||||||| | |||  ||||||| | ||||||||| ||||||  ||||  |||||||| || ||||||||||||    
31318228 actatttcttttcccaccatgctgccttctcgcgtgccctgcaaaatttccgaaaatacccatggtccggattacgtaatccggaccagattgttagtga 31318327  T
169 ttttccataacattaaatctgg-accagatgttttgtgcttttttgtgtctttctttgatgtcaa 232  Q
    ||||    || ||||||| ||| |||| ||||| || || |||||||||||||||||||||||||    
31318328 tttt-tggaaaattaaatatggaaccaaatgttatgcgc-tttttgtgtctttctttgatgtcaa 31318390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 69 - 167
Target Start/End: Original strand, 303453 - 303551
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtg 167  Q
    |||||||||||||||||| ||||| || ||||||| ||||  ||||||| | ||||||||||||||||  ||||| |||||||| || |||||||||||    
303453 actattacttttcccaccctgctgtctcctcgcgcatcctgcaaaatttactaaaatacccctggtccggattatgtaatccggaccagattgttagtg 303551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 69 - 173
Target Start/End: Complemental strand, 31723307 - 31723203
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||| ||||| |||| ||||||||| | ||||  ||||||| | |||||||||||||| |  |||| |||||||||  | |||||| |||||    
31723307 actattactttttccaccatgctcccttctcgcccatcctacaaaatttactaaaatacccctggttcggattacataatccggatcagattgtcagtga 31723208  T
169 ttttc 173  Q
    |||||    
31723207 ttttc 31723203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 167
Target Start/End: Original strand, 34949237 - 34949333
Alignment:
71 tattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtg 167  Q
    |||||||||||||||| || |||||||||||| | |||  |||| || || |||||||||||||||  ||||  |||||||  || |||||||||||    
34949237 tattacttttcccaccctgttgccttctcgcgtgccctgcaaaagttccataaatacccctggtccggattacgtaatccgaaccagattgttagtg 34949333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 69 - 103
Target Start/End: Original strand, 438744 - 438778
Alignment:
69 actattacttttcccaccttgctgccttctcgcgc 103  Q
    |||||||||||||||||| ||||||||||||||||    
438744 actattacttttcccaccatgctgccttctcgcgc 438778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 70 - 108
Target Start/End: Complemental strand, 18460503 - 18460465
Alignment:
70 ctattacttttcccaccttgctgccttctcgcgcgtcct 108  Q
    ||||||||||||||||| || ||||||||||||||||||    
18460503 ctattacttttcccaccctgttgccttctcgcgcgtcct 18460465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Original strand, 480159 - 480191
Alignment:
209 ttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||||||||||||||||||||| ||||||||    
480159 ttttgtgtctttctttgatgtcaagggtctctg 480191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 125
Target Start/End: Complemental strand, 2540170 - 2540114
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaat 125  Q
    |||||||||||||||||| |   |||||||| |||| ||| ||||||||||||||||    
2540170 actattacttttcccaccctatggccttctcccgcgccctgtaaaattttcaaaaat 2540114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 125
Target Start/End: Complemental strand, 7416500 - 7416444
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaat 125  Q
    |||||||||||| |||||||   | |||||| |||||||| ||||||||||||||||    
7416500 actattactttttccaccttatggtcttctcccgcgtcctataaaattttcaaaaat 7416444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 71 - 167
Target Start/End: Original strand, 29435803 - 29435899
Alignment:
71 tattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtg 167  Q
    ||||||||||| |||| || ||||||||||||||  ||  |||| ||||| ||||||||||| |||  ||||  ||||| || || |||||||||||    
29435803 tattacttttctcaccctgttgccttctcgcgcgctctgcaaaaatttcataaatacccctgatccggattacgtaatctggaccagattgttagtg 29435899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 69; Significance: 4e-31; HSPs: 33)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 73 - 241
Target Start/End: Original strand, 49851417 - 49851584
Alignment:
73 ttacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgatttt 172  Q
    |||||||||||||| ||||||||||||||||| |||  ||||||| |||||||||| ||||||| ||||||||||| |||  | |||||||||||| | |    
49851417 ttacttttcccaccctgctgccttctcgcgcgcccttcaaaatttccaaaaataccgctggtccgaattatataattcggatcagattgttagtga-tat 49851515  T
173 ccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||  || |  ||||  |||||||||||| ||||||||||||||||||||||| ||||||| || |||||    
49851516 ccggaaaaagaaattcggaccagatgttatgtgcttttttgtgtctttctttaatgtcaagggcctctg 49851584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 98 - 241
Target Start/End: Complemental strand, 52632761 - 52632619
Alignment:
98 tcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgattttccataacattaaatctggaccagat 197  Q
    ||||||| |||  ||||||||||||||||||||||||||| ||||||||||||||  | |||||||||||| |||||  || |||||||  |||||||||    
52632761 tcgcgcgccctgcaaaattttcaaaaatacccctggtccagattatataatccggatcagattgttagtga-tttccggaaaattaaattcggaccagat 52632663  T
198 gttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
     || || ||||||| |||||||||||||||||||| ||||||||    
52632662 attatgcgctttttggtgtctttctttgatgtcaagggtctctg 52632619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 69 - 241
Target Start/End: Complemental strand, 14587782 - 14587611
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||||||||| |||||||||||| |||  |||  ||||||| | ||||||||| ||||||  |||| |||||||||  | ||||||||||||    
14587782 actattacttttcccaccctgctgccttctcacgcaccctgcaaaatttactaaaatacccatggtccggattacataatccggatcagattgttagtga 14587683  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||| |   ||||  ||||| |||||||||||| |||  |||| ||||||||||||||||||||| ||||||||    
14587682 tttccggaaaca-gaaatccggaccagatgttatgtaattttctgtgtctttctttgatgtcaagggtctctg 14587611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 69 - 241
Target Start/End: Original strand, 29961096 - 29961267
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    ||||||| |||||||||| ||||||||||||||||  | |   |||||| | ||||||||||| ||||  |||| ||||||||| || ||||||||||||    
29961096 actattatttttcccaccctgctgccttctcgcgcaccatgcgaaatttactaaaatacccctagtccggattacataatccggaccagattgttagtga 29961195  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||| |   ||||  |||||||||||||||||| |||| |||| | ||||||||||||||||||| ||||||||    
29961196 tttccggaaacag-aaatctggaccagatgttatgtgtttttctttgtctttctttgatgtcaagggtctctg 29961267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 71 - 241
Target Start/End: Original strand, 44496187 - 44496356
Alignment:
71 tattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgatt 170  Q
    |||||||||||||||  ||||||||||||||||| |||  |||||||   |||||| ||||||||| |||||| |||||||| || ||||||||||||||    
44496187 tattacttttcccactatgctgccttctcgcgcgccctgcaaaatttattaaaataaccctggtccgaattatgtaatccggaccagattgttagtgatt 44496286  T
171 ttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    | |   ||||  |||||  ||||||||||| |||  |||| |||||||||||||| |||||| ||||||||    
44496287 tccggaaaca-gaaatccagaccagatgttatgtaattttatgtgtctttctttgttgtcaagggtctctg 44496356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 73 - 241
Target Start/End: Original strand, 38860386 - 38860552
Alignment:
73 ttacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgatttt 172  Q
    |||||||||||||| |  | ||||||||| || |||  ||||||| ||||||||||||| || |  |||||||||||||| || |||||||||||  |||    
38860386 ttacttttcccaccctatttccttctcgcacgccctgcaaaatttccaaaaataccccttgttcggattatataatccggacccgattgttagtg--ttt 38860483  T
173 ccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||  || |  ||||| |||||||||||| |||| ||||||||||||||||| |||||||| ||||||||    
38860484 ccggaaaacgaaatccggaccagatgttatgtgattttttgtgtctttcttagatgtcaagggtctctg 38860552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 69 - 241
Target Start/End: Complemental strand, 42883028 - 42882857
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    ||||||||||||||||||||||||||| ||||||||||||  ||||||| | |||||||||||| | |  || | |||||| || || |||||||||| |    
42883028 actattacttttcccaccttgctgcctcctcgcgcgtcctgcaaaatttactaaaatacccctgtttcggatcacataatctggaccagattgttagtta 42882929  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||   ||||  ||||  |||||||||||| |||  |||||| | ||||||||||||||||| ||||||||    
42882928 ttttcggaaaca-gaaattcggaccagatgttatgtaattttttttatctttctttgatgtcaagggtctctg 42882857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 69 - 232
Target Start/End: Complemental strand, 3518014 - 3517852
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||||||||| ||||||||||||||||  |||  ||||||| | ||||||| ||||||||  || | |||||||||  | ||||||||||||    
3518014 actattacttttcccaccctgctgccttctcgcgcaccctgcaaaatttactaaaatactcctggtccggatcacataatccggatcagattgttagtga 3517915  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaa 232  Q
    ||| |   ||||  ||||  |||||||||||| |||  |||| |||||||||||||||||||||    
3517914 tttccggaaaca-gaaattcggaccagatgttatgtaattttctgtgtctttctttgatgtcaa 3517852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 69 - 238
Target Start/End: Original strand, 22858457 - 22858625
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    ||||||||||||| || |||||||||| |||||||  |||  ||||||| | |||||||| |||||||  |||| |||||| ||  | ||||||||||||    
22858457 actattacttttctcatcttgctgcctcctcgcgcaccctacaaaatttactaaaatacctctggtccggattacataatctggaacagattgttagtga 22858556  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtct 238  Q
     ||||   |||| |||||| | |||||||||| |||  |||| ||||||||||||||||||||| |||||    
22858557 ctttcagaaaca-taaatccgaaccagatgttatgtaattttctgtgtctttctttgatgtcaagggtct 22858625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 69 - 234
Target Start/End: Complemental strand, 41900719 - 41900556
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    ||||||||||||  ||| |||| ||||||||||| |||||  ||||||| |||||||| ||||| |||  |||||||||| ||| |  | |||||| |||    
41900719 actattactttttacactttgcagccttctcgcgagtcctgcaaaatttccaaaaatatccctgatccggattatataattcggacaaggttgttaatga 41900620  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatg 234  Q
    ||| ||  || |||||||| |||||||||||| |||||||||||||||||||  ||||||| ||||    
41900619 ttt-ccggaa-attaaatccggaccagatgttatgtgcttttttgtgtcttttgttgatgttaatg 41900556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 73 - 241
Target Start/End: Complemental strand, 50262355 - 50262189
Alignment:
73 ttacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgatttt 172  Q
    |||||||| ||||| |  ||||||||| |||| |||  ||||||| ||||||||||||| |||   |||||||||| |||  | |||||||||||  |||    
50262355 ttactttttccaccatattgccttctcacgcgccctgcaaaatttccaaaaatacccctagtctggattatataattcggatccgattgttagtg--ttt 50262258  T
173 ccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||  || |  ||||| |||||||||||| |||| |||||||||||||||||||||||||| ||| ||||    
50262257 ccgaaaaacgaaatccggaccagatgttatgtgattttttgtgtctttctttgatgtcaagggtttctg 50262189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 69 - 241
Target Start/End: Complemental strand, 11952848 - 11952683
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    ||||||||||||||||||   ||||||||| || || |||  ||||||| |||||||| || ||||||  ||   ||||||||| |  ||||||||||||    
11952848 actattacttttcccacc---ctgccttctagctcgccctgcaaaatttccaaaaatatccatggtccggat---ataatccggacaagattgttagtga 11952755  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||| |   || |||||||| |||||||||||| |||| |||||||| ||||||||| ||||||||||||||||    
11952754 tttgcggaaa-attaaatccggaccagatgttatgtgtttttttgtatctttcttttatgtcaatggtctctg 11952683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 92 - 241
Target Start/End: Original strand, 12528174 - 12528321
Alignment:
92 gccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgattttccataacattaaatctgga 191  Q
    ||||||||||||| |||  ||||||||||||||||||||| ||||  |||| |||| ||||  | ||||||||||||  ||||| || |  |||||||||    
12528174 gccttctcgcgcgccctgcaaaattttcaaaaatacccctcgtccggattacataacccggatcagattgttagtga--ttccagaaaacgaaatctgga 12528271  T
192 ccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    | |||| || ||||||||| || || ||||||||||||||| | ||||||    
12528272 ctagatattatgtgcttttctgagtttttctttgatgtcaaggatctctg 12528321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 69 - 238
Target Start/End: Complemental strand, 44757969 - 44757802
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||||||||| ||||||||||||||||| |||  |||| ||||| |||||||||| || || ||||  |||||||  || |||||||||||     
44757969 actattacttttcccaccatgctgccttctcgcgcgccctgcaaaaatttcataaatacccctagttcagattacgtaatccgaaccagattgttagtg- 44757871  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtct 238  Q
     |||||  ||    ||||| || ||||||||| |||  |||| ||||| ||||||||||||||| |||||    
44757870 -tttccggaaacagaaatccgggccagatgttatgtaattttctgtgtatttctttgatgtcaagggtct 44757802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 72 - 241
Target Start/End: Complemental strand, 48965327 - 48965159
Alignment:
72 attacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgattt 171  Q
    |||||||||  |||| ||||||||||| ||||| ||| |||||||| | |||||||| ||| | |  |||| ||||||||| || |||||||||||||||    
48965327 attacttttttcaccctgctgccttcttgcgcgccctgtaaaatttactaaaataccactgattcggattacataatccggaccagattgttagtgattt 48965228  T
172 tccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
         ||||  ||||| ||||||||| || |||  |||| ||||||||||||||||||||| ||||||||    
48965227 ctggaaaca-gaaatccggaccagatattatgtaattttctgtgtctttctttgatgtcaaaggtctctg 48965159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 69 - 241
Target Start/End: Original strand, 33801061 - 33801232
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||||||||| | ||||||||||||||||||| | |  ||  | ||||||||| | ||||  ||| ||||||||||  | ||||||||||||    
33801061 actattacttttcccaccctactgccttctcgcgcgtcctgtgattttgaccaaaataccctttgtccggattgtataatccggatcagattgttagtga 33801160  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||| |   ||||  ||||  ||||||||| || |||  |||| ||||||||||||||||||||| ||||||||    
33801161 tttccggaaaca-gaaattcggaccagatattatgtaattttctgtgtctttctttgatgtcaagggtctctg 33801232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 120 - 241
Target Start/End: Complemental strand, 23984418 - 23984298
Alignment:
120 aaaaatacccctggtccaaattatataatccggtccggattgttagtgattttccataacattaaatctggaccagatgttttgtgcttttttgtgtctt 219  Q
    ||||||| ||||| |||| |||||||||||| | || ||||||||||||| | |   || |  | ||| |||||||||||| |||| |||||||||||||    
23984418 aaaaataaccctgatccagattatataatccagaccagattgttagtgatgt-caggaaaacgatatccggaccagatgttatgtgtttttttgtgtctt 23984320  T
220 tctttgatgtcaatggtctctg 241  Q
    |||||||||||||| |||||||    
23984319 tctttgatgtcaatagtctctg 23984298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 69 - 167
Target Start/End: Complemental strand, 5750225 - 5750127
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtg 167  Q
    |||||||||||||||||| ||  ||||||||| ||| |||  |||| || ||||||||||||||||||  ||||  |||||||| || |||||||||||    
5750225 actattacttttcccaccctgtagccttctcgggcgccctgcaaaaattccaaaaatacccctggtccggattacgtaatccggaccagattgttagtg 5750127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 241
Target Start/End: Original strand, 37952087 - 37952170
Alignment:
157 gattgttagtgattttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||||||||||||||| | | ||||  ||||||||||||||| || |||  |||| ||||||||||||||||||||| ||||||||    
37952087 gattgttagtgatttccgaaaacag-aaatctggaccagatattatgtaattttctgtgtctttctttgatgtcaagggtctctg 37952170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 183 - 241
Target Start/End: Complemental strand, 12700869 - 12700811
Alignment:
183 aaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||||| |||||||||||| |||  ||||||||||||||||||||| |||| ||||||||    
12700869 aaatccggaccagatgttatgtaattttttgtgtctttctttgatatcaagggtctctg 12700811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 69 - 167
Target Start/End: Original strand, 18271972 - 18272070
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtg 167  Q
    |||||| ||||||||||| || |||||||||||||| ||   |||| || || |||||||| ||||| | ||||| |||||||| || |||||||||||    
18271972 actattgcttttcccaccctgttgccttctcgcgcgcccagcaaaaattccataaatacccttggtctagattatgtaatccggaccagattgttagtg 18272070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 69 - 167
Target Start/End: Original strand, 18276626 - 18276724
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtg 167  Q
    |||||| ||||||||||| || |||||||||||||| ||   |||| || || |||||||| ||||| | ||||| |||||||| || |||||||||||    
18276626 actattgcttttcccaccctgttgccttctcgcgcgcccagcaaaaattccataaatacccttggtctagattatgtaatccggaccagattgttagtg 18276724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 73 - 241
Target Start/End: Original strand, 27216506 - 27216674
Alignment:
73 ttacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgatttt 172  Q
    |||||||||||||||| |||| |||||||||| |||  |||| ||||||||||| | ||| |||    ||||||||| || |   ||||||| ||||||     
27216506 ttacttttcccaccttactgctttctcgcgcgccctgcaaaaatttcaaaaatatctctgatccgggctatataatcaggacaatattgttattgattt- 27216604  T
173 ccataacattaaatctggaccagat-gttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||  || |  ||||  |||||| || ||| |||||||||| |||||||||||||||||||| ||||||||    
27216605 ccggaaaacgaaattcggaccatattgttatgtgctttttagtgtctttctttgatgtcaagggtctctg 27216674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 209 - 241
Target Start/End: Complemental strand, 7199770 - 7199738
Alignment:
209 ttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||||||||||||||||||||||||||||||    
7199770 ttttgtgtctttctttgatgtcaatggtctctg 7199738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 73 - 136
Target Start/End: Complemental strand, 6606034 - 6605971
Alignment:
73 ttacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtcc 136  Q
    |||||||||||||| ||| || |||||||||  ||| ||||| |||||| ||||||||||||||    
6606034 ttacttttcccaccctgccgctttctcgcgcaccctataaaaatttcaataatacccctggtcc 6605971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 69 - 132
Target Start/End: Original strand, 41086119 - 41086182
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctg 132  Q
    |||||||||||||| | | |||||||||||||||||  ||  ||||||| ||||||||||||||    
41086119 actattacttttcctatcctgctgccttctcgcgcgctctgcaaaatttccaaaaatacccctg 41086182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 69 - 132
Target Start/End: Original strand, 41090887 - 41090950
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctg 132  Q
    |||||||||||||| | | |||||||||||||||||  ||  ||||||| ||||||||||||||    
41090887 actattacttttcctatcctgctgccttctcgcgcgctctgcaaaatttccaaaaatacccctg 41090950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 69 - 167
Target Start/End: Complemental strand, 12525336 - 12525239
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtg 167  Q
    ||||||||||||||||| ||| ||||||||||||| |||   |||| || || |||||||||||||||  ||||  |||||||| ||  ||||||||||    
12525336 actattacttttcccacattgttgccttctcgcgc-tccctgaaaaattccataaatacccctggtccggattacgtaatccggaccaaattgttagtg 12525239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 69 - 167
Target Start/End: Complemental strand, 22335333 - 22335235
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtg 167  Q
    |||| ||||||||||||| |  |||||||||||||| |||  |||| ||  | |||||||||||||||  ||||  |||||||| || |||||||||||    
22335333 actactacttttcccaccctattgccttctcgcgcgccctgcaaaaattctataaatacccctggtccggattacgtaatccggaccagattgttagtg 22335235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Original strand, 18272110 - 18272142
Alignment:
209 ttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||||||||||||||||||||| ||||||||    
18272110 ttttgtgtctttctttgatgtcaagggtctctg 18272142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Original strand, 18276764 - 18276796
Alignment:
209 ttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||||||||||||||||||||| ||||||||    
18276764 ttttgtgtctttctttgatgtcaagggtctctg 18276796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 125
Target Start/End: Original strand, 32817250 - 32817306
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaat 125  Q
    |||||||||||||||||| |   |||||||| |||| ||| ||||||||||||||||    
32817250 actattacttttcccaccctatagccttctcccgcgccctgtaaaattttcaaaaat 32817306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 73 - 137
Target Start/End: Original strand, 50890246 - 50890310
Alignment:
73 ttacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtcca 137  Q
    |||||||||| ||| |||||||||||| | || |||  |||| |||||||||||| |||||||||    
50890246 ttacttttcctaccctgctgccttctcacacgccctgcaaaaatttcaaaaatactcctggtcca 50890310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 64; Significance: 4e-28; HSPs: 20)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 69 - 241
Target Start/End: Original strand, 13278394 - 13278569
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||| ||||| ||||| ||||||||||| ||| |||||||| |||||||||| |||||||  |||||||||| ||| |  ||||||||||||    
13278394 actattactttttccaccctgctgtcttctcgcgcgccctgtaaaatttacaaaaatacctctggtccggattatataattcggactagattgttagtga 13278493  T
169 ttttccataacattaaatctggaccagatg----ttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
     | |||  || |  ||||| ||||||||||    || |||| |||||||||||||||||||||||||||||||||||    
13278494 -tatccgaaaaacgaaatccggaccagatgttaattatgtgtttttttgtgtctttctttgatgtcaatggtctctg 13278569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 73 - 241
Target Start/End: Complemental strand, 7943169 - 7943004
Alignment:
73 ttacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgatttt 172  Q
    |||||||||||||| ||||||||||||||||  |||  ||||||| | ||||||||||||||||   ||| ||||||||| |  |||||||||||||||     
7943169 ttacttttcccaccgtgctgccttctcgcgc--cctgcaaaatttactaaaatacccctggtcctgtttacataatccggactagattgttagtgattt- 7943073  T
173 ccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||  || |  ||||| ||| ||||| ||  |||||||||||||||||||||||||||||||||||||||    
7943072 ccggaaaacgaaatccggatcagatattacgtgcttttttgtgtctttctttgatgtcaatggtctctg 7943004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 69 - 241
Target Start/End: Complemental strand, 38707653 - 38707482
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||||||||  ||||||||||||||||  |||  ||||||| | ||||||||| ||||||  |||| |||||||||  | ||||||||||||    
38707653 actattacttttcccactctgctgccttctcgcgcaccctgaaaaatttactaaaatacccatggtccggattacataatccggatcagattgttagtga 38707554  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||| |   |||| |||||  |||| ||||||| |||  |||| ||||||||||||||||||||| ||||||||    
38707553 tttccggaaaca-taaattcggacaagatgttatgtaattttctgtgtctttctttgatgtcaagggtctctg 38707482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 73 - 241
Target Start/End: Original strand, 18137299 - 18137464
Alignment:
73 ttacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgatttt 172  Q
    |||||||||||||| ||||||||||||||||| | |  ||||||| |||||||||||||||| |  |||||||||||||| |  ||||||||||||        
18137299 ttacttttcccaccctgctgccttctcgcgcgccttgcaaaatttccaaaaatacccctggttcggattatataatccggacaagattgttagtga---- 18137394  T
173 ccataacattaaatctggaccaga-tgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||  || |  ||||  |||||| | |||| |||||||||||||| |||||||||||||||  ||||||||    
18137395 ccggaaaacgaaattcggaccatattgttatgtgcttttttgtgcctttctttgatgtcaggggtctctg 18137464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 73 - 238
Target Start/End: Complemental strand, 31994505 - 31994342
Alignment:
73 ttacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtgatttt 172  Q
    |||||||| | ||| ||||||||||||||||| |||  || |||  | |||||||| | ||||   |||||||||||||| || |||||||| || |||     
31994505 ttactttttctaccctgctgccttctcgcgcgccctgcaatattcactaaaatacctcaggtctggattatataatccggaccagattgtta-tgcttt- 31994408  T
173 ccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtct 238  Q
    ||| || |  |||| ||||||||||||| |||||||||||||||||||||||||||| || |||||    
31994407 ccagaaaacgaaatatggaccagatgttatgtgcttttttgtgtctttctttgatgttaagggtct 31994342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 69 - 238
Target Start/End: Original strand, 45116784 - 45116951
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||||||||| ||||| ||||||||||| |||  ||||||| | ||||||  ||||||||  |||| ||||||||  || ||||||||||||    
45116784 actattacttttcccaccatgctgtcttctcgcgcgccctgcaaaatttactaaaata-acctggtccggattacataatccgaaccagattgttagtga 45116882  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtct 238  Q
     |||||  ||    ||||| |||| ||||||| |||  |||| ||||||||||||||||||||| |||||    
45116883 -tttccggaagcagaaatccggactagatgttatgtaattttatgtgtctttctttgatgtcaagggtct 45116951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 69 - 241
Target Start/End: Original strand, 15911482 - 15911653
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    |||||||||||||||||| ||||||||||||||||  |||  ||||||| | ||||||  ||| |||  ||||| ||||| |||  | ||||||||||||    
15911482 actattacttttcccaccctgctgccttctcgcgcaccctgcaaaatttactaaaatataccttgtctgaattacataattcggatcagattgttagtga 15911581  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||| |   ||||  |||||  ||||||||||| |||  |||| ||||||||||||||||| ||| ||||||||    
15911582 tttccggaaaca-gaaatccagaccagatgttatgtaattttctgtgtctttctttgatgccaagggtctctg 15911653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 69 - 136
Target Start/End: Complemental strand, 17138109 - 17138042
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtcc 136  Q
    |||||||||||||||||| |||||||| |||||||| ||| |||||||| | ||||||||||||||||    
17138109 actattacttttcccaccctgctgcctcctcgcgcgccctataaaatttactaaaatacccctggtcc 17138042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 71 - 136
Target Start/End: Original strand, 24167093 - 24167158
Alignment:
71 tattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtcc 136  Q
    |||||||||||||||  |||||||||||| ||||||||  |||| |||||||||||||||||||||    
24167093 tattacttttcccactctgctgccttctcacgcgtcctgcaaaaatttcaaaaatacccctggtcc 24167158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 69 - 167
Target Start/End: Complemental strand, 5464813 - 5464715
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtg 167  Q
    ||||||||||||||||||||  ||||||||||||||  ||  |||| ||||| |||||||||||||||  ||||| ||||| || ||  ||||||||||    
5464813 actattacttttcccaccttattgccttctcgcgcgctctgcaaaaatttcataaatacccctggtccggattatgtaatctggaccaaattgttagtg 5464715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 77 - 167
Target Start/End: Original strand, 43333528 - 43333618
Alignment:
77 ttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtg 167  Q
    ||||||||||||| ||||||||||||||||||  |||| || || |||||| ||||||||  ||||  |||||||| || |||||||||||    
43333528 ttttcccaccttgttgccttctcgcgcgtcctgcaaaaattccataaatactcctggtccggattacgtaatccgggccagattgttagtg 43333618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 69 - 241
Target Start/End: Original strand, 38207189 - 38207354
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtccaaattatataatccggtccggattgttagtga 168  Q
    ||||||| |||||||||| |||||||| ||||||| ||||  ||||||| | ||||||      |||   |||| |||||||||  | ||||||||||||    
38207189 actattatttttcccaccctgctgcctcctcgcgcatcctgcaaaatttactaaaata------gtctggattacataatccggatcagattgttagtga 38207282  T
169 ttttccataacattaaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||   ||||  ||||| |||||||||||| |||  |||| ||| ||||||||||||||||| ||||||||    
38207283 ttttcggaaacag-aaatccggaccagatgttatgtaattttctgtatctttctttgatgtcaacggtctctg 38207354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 190 - 232
Target Start/End: Complemental strand, 1210244 - 1210202
Alignment:
190 gaccagatgttttgtgcttttttgtgtctttctttgatgtcaa 232  Q
    ||||||||||| ||||||||| |||||||||||||||||||||    
1210244 gaccagatgttatgtgcttttctgtgtctttctttgatgtcaa 1210202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 241
Target Start/End: Original strand, 6402695 - 6402753
Alignment:
183 aaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||||| |||||||||||| |||  |||| |||||||||||||||||||||  |||||||    
6402695 aaatcaggaccagatgttatgtaattttatgtgtctttctttgatgtcaagagtctctg 6402753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 72 - 125
Target Start/End: Original strand, 9846976 - 9847029
Alignment:
72 attacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaat 125  Q
    ||||||||||||||| |  |||||||||||||| ||| |||||||| |||||||    
9846976 attacttttcccaccctattgccttctcgcgcgccctgtaaaatttccaaaaat 9847029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 208 - 241
Target Start/End: Original strand, 18963186 - 18963219
Alignment:
208 tttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||||||||||||||||||||||||| ||||||||    
18963186 tttttgtgtctttctttgatgtcaagggtctctg 18963219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 219
Target Start/End: Original strand, 1114578 - 1114614
Alignment:
183 aaatctggaccagatgttttgtgcttttttgtgtctt 219  Q
    ||||| |||||||||||| ||||||||||||||||||    
1114578 aaatccggaccagatgttatgtgcttttttgtgtctt 1114614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Complemental strand, 15113635 - 15113603
Alignment:
209 ttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||||||||||||||||||||| ||||||||    
15113635 ttttgtgtctttctttgatgtcaagggtctctg 15113603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Original strand, 34948324 - 34948356
Alignment:
209 ttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||||||||||||||||||||| ||||||||    
34948324 ttttgtgtctttctttgatgtcaagggtctctg 34948356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 209 - 241
Target Start/End: Original strand, 43333658 - 43333690
Alignment:
209 ttttgtgtctttctttgatgtcaatggtctctg 241  Q
    |||||||||||||||||||||||| ||||||||    
43333658 ttttgtgtctttctttgatgtcaagggtctctg 43333690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1301 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 2)
Name: scaffold1301
Description:

Target: scaffold1301; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 69 - 136
Target Start/End: Original strand, 1373 - 1439
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtcc 136  Q
    ||||||||||||||||||||| || ||||||| ||| ||| |||||||||| ||||||||||||||||    
1373 actattacttttcccaccttgatgtcttctcgtgcg-cctgtaaaattttctaaaatacccctggtcc 1439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1301; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 241
Target Start/End: Original strand, 1473 - 1531
Alignment:
183 aaatctggaccagatgttttgtgcttttttgtgtctttctttgatgtcaatggtctctg 241  Q
    ||||| |||||| ||||| || | |||| ||||||||||||||||||||| ||||||||    
1473 aaatccggaccatatgttatgcgattttctgtgtctttctttgatgtcaagggtctctg 1531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0168 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0168
Description:

Target: scaffold0168; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 69 - 136
Target Start/End: Original strand, 11902 - 11969
Alignment:
69 actattacttttcccaccttgctgccttctcgcgcgtcctctaaaattttcaaaaatacccctggtcc 136  Q
    ||||||||||| | ||||||| |||||||||||||| |||  |||| || ||||| ||||||||||||    
11902 actattactttcctcaccttgatgccttctcgcgcgccctgcaaaaattccaaaattacccctggtcc 11969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University