View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8503_low_28 (Length: 404)
Name: NF8503_low_28
Description: NF8503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8503_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 23 - 399
Target Start/End: Original strand, 52807243 - 52807622
Alignment:
| Q |
23 |
aacttccacaatcgcatgagtttgtcataaaacacaacttccacgtcattgccacaaaccaaaggaaaataggtaactgcatgttttttcgggacgacaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52807243 |
aacttccacaatcgcatgagtttgtcataaaacacaacttccacgtcattgccacaaaccaaaggaaaataggtaactgcatgttttttcgggacgacaa |
52807342 |
T |
 |
| Q |
123 |
gcctattgagtttaccaacatcacttggtgttaattctttttgaaaaagtagttgtgtgcaagaaaattgttcctcacccttcacccctataacaacacc |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52807343 |
gcctattgagtttaccaacatcacttggtgttaattctttttgaaaaagtagttgtgtgcaagaaaattgttcctcatccttcacccctataacaacacc |
52807442 |
T |
 |
| Q |
223 |
ttctttgcctgcaccttgg---ctttcattatttctaagaaatgttgttgcaaaattagaggggtatgttccatttctaatcatgatcataattgtttcc |
319 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52807443 |
ttctttgcctgcaccttggcgcctttcattatttctaagaaatgttgttgcaaaattagaggggtatgttccatttctaatcatgatcataattgtttcc |
52807542 |
T |
 |
| Q |
320 |
atgttatattgactttgaaacataggttcttcaactgtttggttattccatgcaaagtttctatggctttctctgcttct |
399 |
Q |
| |
|
||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52807543 |
atgctatattgactttgaaacataggttcttgaactgtttggttattccatgcaaagtttctatggctttctctgcttct |
52807622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University