View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8503_low_43 (Length: 336)
Name: NF8503_low_43
Description: NF8503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8503_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 317
Target Start/End: Original strand, 42686249 - 42686558
Alignment:
| Q |
19 |
aattactagctattttccttgtgttctttcctcgtttgagttttgtgnnnnnnnnnatgatcaacttgtacatagaaattatggcacattacatattgca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42686249 |
aattactagctattttccttgtgttctttcctcgtttgagttttgtgtttttttt-atgatcaacttgtacatagaaattatggcacattacatattgca |
42686347 |
T |
 |
| Q |
119 |
nnnnnnnnnn-gaaggaattacatattgccttttgtttgctggtgtgtgaattttg-----------ttacaatatcacatggtatagccatgtaaaaaa |
206 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42686348 |
tttttttttttgaaggaattacatattgcattttgtttgctggtatgtgaattttggttctcttctattacaatatcacatggtatagccatgtaaaaaa |
42686447 |
T |
 |
| Q |
207 |
ttgtgtgtctctctattagtaaatagtaaccatcaatgaaatttgatattatcatttatttaatactcatgagaagagaaatatgttcaatttaacgata |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42686448 |
ttgtgtgtctctctattagtaaatagtaaccatcaatgaaatttgatattatcatttatttaatactcatgagaagagaaatatgttcaatttaacgata |
42686547 |
T |
 |
| Q |
307 |
atgacttaaac |
317 |
Q |
| |
|
||||||||||| |
|
|
| T |
42686548 |
atgacttaaac |
42686558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University