View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8503_low_47 (Length: 326)
Name: NF8503_low_47
Description: NF8503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8503_low_47 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 291; Significance: 1e-163; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 16 - 314
Target Start/End: Complemental strand, 7500884 - 7500586
Alignment:
| Q |
16 |
tcattctcatctttctattttaataaatattcatttgctgcttaaagaaaactcccttcacccatcatgaataatttcagtaggttagatccagacatca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7500884 |
tcattctcatctttctattttaataaatattcatttgctgctaaaagaaaactcccttcacccatcatgaataatttcagtaggttagatccagacatca |
7500785 |
T |
|
| Q |
116 |
tccagacctatatccttccacgcctcgatggggcagccttaatggcattgtcctgtgtatgttctgaccttcgccacttgatctgcaacaacgaggaatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7500784 |
tccagacctatatccttccacgcctcgatggggcagccttaatggcattgtcctgtgtatgttccgaccttcgccacttgatctgcaacaacgaggaatt |
7500685 |
T |
|
| Q |
216 |
atggcggaacatttgcacctccatgtggccttgccttctgcatccaaccgttagccacattatcaccactttccctggtggttaccgttccttcttctc |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7500684 |
atggcggaacatttgcacctccatgtggccttgccttctgcatccaaccgttagccacattatcaccactttccctggtggttaccgttccttcttctc |
7500586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 215 - 314
Target Start/End: Complemental strand, 7502118 - 7502019
Alignment:
| Q |
215 |
tatggcggaacatttgcacctccatgtggccttgccttctgcatccaaccgttagccacattatcaccactttccctggtggttaccgttccttcttctc |
314 |
Q |
| |
|
|||||||||| ||||||||||| | |||||||| |||| || |||||| ||||| | | | ||| |||||||||| ||||||||| |||| |||||||| |
|
|
| T |
7502118 |
tatggcggaatatttgcacctcaaagtggccttcccttatggatccaatcgttaacgatgtcatctccactttccccggtggttacagttcattcttctc |
7502019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 76 - 116
Target Start/End: Original strand, 8057200 - 8057240
Alignment:
| Q |
76 |
cccatcatgaataatttcagtaggttagatccagacatcat |
116 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8057200 |
cccatcatgaataatttcagtaggttatgtccagacatcat |
8057240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 91 - 247
Target Start/End: Original strand, 27240723 - 27240882
Alignment:
| Q |
91 |
ttcagtaggttagatccagacatcatccagacctatatccttccacgcctcgatggggcagccttaatggcattgtcctgtgtatgttctgaccttcgcc |
190 |
Q |
| |
|
|||||||||||||||||||||||||| || ||| | |||||||| |||||||| || || ||||||| | || | || ||||||||| || || || | |
|
|
| T |
27240723 |
ttcagtaggttagatccagacatcatgcatacccacatccttccccgcctcgacggcacaaccttaatcgtcttattctctgtatgttcagaactccgtc |
27240822 |
T |
|
| Q |
191 |
acttgatctg---caacaacgaggaattatggcggaacatttgcacctccatgtggcctt |
247 |
Q |
| |
|
|| |||| || ||||||||| || ||||||||||||| |||||||| | |||||||| |
|
|
| T |
27240823 |
acatgatttgccacaacaacgaagatctatggcggaacatatgcacctcaaagtggcctt |
27240882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 166 - 233
Target Start/End: Original strand, 27253110 - 27253177
Alignment:
| Q |
166 |
tcctgtgtatgttctgaccttcgccacttgatctgcaacaacgaggaattatggcggaacatttgcac |
233 |
Q |
| |
|
|||||||||| ||| || || |||||| |||||||||||||||| || ||||||||||||| ||||| |
|
|
| T |
27253110 |
tcctgtgtatcttcagaactccgccacatgatctgcaacaacgaagatctatggcggaacatatgcac |
27253177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 277 - 314
Target Start/End: Original strand, 27240915 - 27240952
Alignment:
| Q |
277 |
atcaccactttccctggtggttaccgttccttcttctc |
314 |
Q |
| |
|
||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
27240915 |
atctccactttccctggtggttaccgttcctttttctc |
27240952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 281 - 314
Target Start/End: Original strand, 27246448 - 27246481
Alignment:
| Q |
281 |
ccactttccctggtggttaccgttccttcttctc |
314 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
27246448 |
ccactttccctggtggttaccattccttcttctc |
27246481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University