View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8503_low_51 (Length: 308)
Name: NF8503_low_51
Description: NF8503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8503_low_51 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 20 - 164
Target Start/End: Original strand, 23023066 - 23023213
Alignment:
| Q |
20 |
aaataaatcaattatttataaatgatgtaggtggaaattcttcataggttaaaaaatcaaaatacctgcag---aatgcaaaaggttaacatcttgtatt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23023066 |
aaataaatcaattatttataaatgatgtaggtggaaattcttcataggttaaaaaatcaaaatacctgcagattaatgcaaaaggttaacatcttgtatt |
23023165 |
T |
|
| Q |
117 |
tataagggtgtagatatatttgcaagttattgaaaattccgatactaa |
164 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23023166 |
tataagggtgtagatatctttgcaagttattgaaaattccgatactaa |
23023213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 162 - 285
Target Start/End: Original strand, 23013682 - 23013805
Alignment:
| Q |
162 |
taattgaaacacgattacaaaatagtgagatagacctccctctcctctgatcgtcgaaaaccttcttattgaattggaattgttcccttctgaacatgac |
261 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23013682 |
taattgaaacacgattacgacatagtgagatagacctccctctcttctgattgtcgaaaaccttcttattgaattggaattgttcccttctgaacatgac |
23013781 |
T |
|
| Q |
262 |
ctttttcccttcctaatcatccat |
285 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
23013782 |
ctttttcccttcctaatcatccat |
23013805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University